Gene Page: FAM134A
Summary ?
| GeneID | 79137 |
| Symbol | FAM134A |
| Synonyms | C2orf17 |
| Description | family with sequence similarity 134 member A |
| Reference | HGNC:HGNC:28450|Ensembl:ENSG00000144567|HPRD:12807|Vega:OTTHUMG00000154577 |
| Gene type | protein-coding |
| Map location | 2q35 |
| Pascal p-value | 5.148E-5 |
| Sherlock p-value | 0.197 |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| Expression | Meta-analysis of gene expression | P value: 2.206 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ITGB2 | 0.71 | 0.65 |
| CCR1 | 0.69 | 0.58 |
| CTSS | 0.69 | 0.59 |
| CSF1R | 0.68 | 0.64 |
| LAPTM5 | 0.68 | 0.61 |
| CYBB | 0.66 | 0.52 |
| CD4 | 0.66 | 0.63 |
| HCK | 0.66 | 0.58 |
| LPAR5 | 0.65 | 0.61 |
| SELPLG | 0.65 | 0.60 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC005921.3 | -0.24 | -0.24 |
| ANP32C | -0.23 | -0.22 |
| RBMX2 | -0.22 | -0.23 |
| CLK1 | -0.22 | -0.23 |
| CIR1 | -0.22 | -0.21 |
| SNHG12 | -0.22 | -0.23 |
| AC145146.3 | -0.21 | -0.16 |
| RP9P | -0.21 | -0.26 |
| ANKRD36B | -0.21 | -0.22 |
| AC010300.1 | -0.21 | -0.17 |
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
| LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
| WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| IVANOVSKA MIR106B TARGETS | 90 | 56 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 UP | 87 | 52 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 354 | 361 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-142-5p | 409 | 416 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-15/16/195/424/497 | 366 | 372 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-17-5p/20/93.mr/106/519.d | 407 | 414 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-214 | 153 | 159 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.