Gene Page: FZD3
Summary ?
| GeneID | 7976 |
| Symbol | FZD3 |
| Synonyms | Fz-3 |
| Description | frizzled class receptor 3 |
| Reference | MIM:606143|HGNC:HGNC:4041|Ensembl:ENSG00000104290|HPRD:05849|Vega:OTTHUMG00000102145 |
| Gene type | protein-coding |
| Map location | 8p21 |
| Pascal p-value | 0.012 |
| Fetal beta | 1.462 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06931245 | 8 | 28351501 | FZD3 | 3.78E-5 | -0.369 | 0.02 | DMG:Wockner_2014 |
| cg04046704 | 8 | 28352643 | FZD3 | 4.319E-4 | 0.31 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2341792 | chr8 | 29333630 | FZD3 | 7976 | 0.12 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | IEA | - | |
| GO:0004930 | G-protein coupled receptor activity | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0004926 | non-G-protein coupled 7TM receptor activity | IEA | - | |
| GO:0042813 | Wnt receptor activity | TAS | 10777673 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001736 | establishment of planar polarity | IEA | - | |
| GO:0001843 | neural tube closure | IEA | - | |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0016055 | Wnt receptor signaling pathway | IEA | - | |
| GO:0008283 | cell proliferation | TAS | 10491302 | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0042472 | inner ear morphogenesis | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 10491302 | |
| GO:0045177 | apical part of cell | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG BASAL CELL CARCINOMA | 55 | 44 | All SZGR 2.0 genes in this pathway |
| WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM5 | 94 | 59 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 SIGNALING VIA CTNNB1 | 83 | 58 | All SZGR 2.0 genes in this pathway |
| OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS DN | 234 | 137 | All SZGR 2.0 genes in this pathway |
| DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| OUILLETTE CLL 13Q14 DELETION DN | 60 | 38 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 942 | 949 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-31 | 940 | 947 | 1A,m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-378* | 1101 | 1107 | 1A | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
| hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
| miR-96 | 943 | 949 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.