Gene Page: TBC1D10A

Summary
GeneID  83874
Symbol  TBC1D10A
Synonyms  EPI64|TBC1D10|dJ130H16.1|dJ130H16.2
Description  TBC1 domain family, member 10A
See related  HGNC:23609|MIM:610020|Ensembl:ENSG00000099992|HPRD:18162|
Locus tag  -
Gene type  protein-coding
Map location  22q12.1-qter
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005097Rab GTPase activator activityIEA-
GO:0005515protein bindingIPI11285285 
GO:0030165PDZ domain bindingIPI11285285 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
GO:0032313regulation of Rab GTPase activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIDA18029348 
GO:0005622intracellularIEA-
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0005902microvillusTAS11285285 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrin-HPRD11285285 
SLC9A3R1EBP50 | NHERF | NHERF1 | NPHLOP2solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1-HPRD,BioGRID11285285 
SLC9A3R2E3KARP | MGC104639 | NHE3RF2 | NHERF-2 | NHERF2 | OCTS2 | SIP-1 | SIP1 | TKA-1solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2-HPRD11285285 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-22353601A,m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.