Gene Page: TBC1D10A
Summary ?
| GeneID | 83874 |
| Symbol | TBC1D10A |
| Synonyms | EPI64|TBC1D10|dJ130H16.1|dJ130H16.2 |
| Description | TBC1 domain family member 10A |
| Reference | MIM:610020|HGNC:HGNC:23609|Ensembl:ENSG00000099992|HPRD:18162|Vega:OTTHUMG00000150924 |
| Gene type | protein-coding |
| Map location | 22q12.2 |
| Pascal p-value | 0.002 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005097 | Rab GTPase activator activity | IEA | - | |
| GO:0005515 | protein binding | IPI | 11285285 | |
| GO:0030165 | PDZ domain binding | IPI | 11285285 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| GO:0032313 | regulation of Rab GTPase activity | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005856 | cytoskeleton | IDA | 18029348 | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0005902 | microvillus | TAS | 11285285 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| XU CREBBP TARGETS DN | 44 | 31 | All SZGR 2.0 genes in this pathway |
| PAL PRMT5 TARGETS DN | 29 | 16 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-223 | 53 | 60 | 1A,m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.