Gene Page: IRS2
Summary ?
GeneID | 8660 |
Symbol | IRS2 |
Synonyms | IRS-2 |
Description | insulin receptor substrate 2 |
Reference | MIM:600797|HGNC:HGNC:6126|Ensembl:ENSG00000185950|HPRD:02878|Vega:OTTHUMG00000017338 |
Gene type | protein-coding |
Map location | 13q34 |
Pascal p-value | 0.024 |
Fetal beta | 0.188 |
Support | CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C10orf118 | 0.94 | 0.95 |
CAMSAP1L1 | 0.94 | 0.95 |
RABEP1 | 0.93 | 0.95 |
BAG5 | 0.93 | 0.94 |
CUL5 | 0.92 | 0.94 |
UBE3A | 0.92 | 0.94 |
SLC25A36 | 0.92 | 0.94 |
KRAS | 0.92 | 0.94 |
ARFGEF1 | 0.92 | 0.94 |
ZYG11B | 0.92 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.69 | -0.78 |
HSD17B14 | -0.68 | -0.74 |
AF347015.31 | -0.67 | -0.76 |
CST3 | -0.67 | -0.78 |
TLCD1 | -0.67 | -0.75 |
ROM1 | -0.66 | -0.73 |
MT-CO2 | -0.66 | -0.76 |
ENHO | -0.66 | -0.80 |
EIF4EBP3 | -0.66 | -0.72 |
METRN | -0.66 | -0.78 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004871 | signal transducer activity | TAS | 7675087 |9495343 | |
GO:0005158 | insulin receptor binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0019901 | protein kinase binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | IEA | Brain (GO term level: 7) | - |
GO:0006006 | glucose metabolic process | TAS | 9495343 | |
GO:0007165 | signal transduction | TAS | 7675087 | |
GO:0008283 | cell proliferation | IEA | - | |
GO:0008286 | insulin receptor signaling pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | EXP | 12167717 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ATP2A1 | ATP2A | SERCA1 | ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 | - | HPRD | 9295312 |
BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | Affinity Capture-Western | BioGRID | 10679027 |
BCL2L1 | BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS | BCL2-like 1 | - | HPRD | 10679027 |
EPOR | MGC138358 | erythropoietin receptor | - | HPRD,BioGRID | 9334184 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 9852124 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | - | HPRD | 9852124 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | Insulin Receptor Substrate-2 Binds to the Insulin-like Growth Factor Receptor Beta subunit. This interaction is modeled on demonstrated interaction between human IGF-IR and murine IRS-2 | BIND | 8626379 |
IL4R | CD124 | IL4RA | interleukin 4 receptor | - | HPRD,BioGRID | 8954948 |
INSR | CD220 | HHF5 | insulin receptor | - | HPRD,BioGRID | 8626379 |
INSR | CD220 | HHF5 | insulin receptor | Insulin Receptor Substrate-2 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and murine IRS-2. | BIND | 8626379 |
JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | - | HPRD,BioGRID | 7499365 |
JAK3 | JAK-3 | JAK3_HUMAN | JAKL | L-JAK | LJAK | Janus kinase 3 (a protein tyrosine kinase, leukocyte) | - | HPRD | 7499365 |
NISCH | FLJ14425 | FLJ40413 | FLJ90519 | I-1 | IRAS | KIAA0975 | nischarin | Affinity Capture-Western | BioGRID | 11912194 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD,BioGRID | 9852124 |12107746 |
PIK3R3 | DKFZp686P05226 | FLJ41892 | p55 | p55-GAMMA | phosphoinositide-3-kinase, regulatory subunit 3 (gamma) | Affinity Capture-Western | BioGRID | 10417350 |
PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | - | HPRD,BioGRID | 9535722 |
PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD,BioGRID | 8910607 |
SFN | YWHAS | stratifin | Affinity Capture-MS | BioGRID | 15778465 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD | 11505033 |
SOCS1 | CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 | suppressor of cytokine signaling 1 | Affinity Capture-Western | BioGRID | 12228220 |
TYK2 | JTK1 | tyrosine kinase 2 | - | HPRD,BioGRID | 8550573 |
UBTF | NOR-90 | UBF | upstream binding transcription factor, RNA polymerase I | - | HPRD,BioGRID | 12554758 |
YWHAB | GW128 | HS1 | KCIP-1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
YWHAE | 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide | - | HPRD,BioGRID | 9312143 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
YWHAQ | 14-3-3 | 1C5 | HS1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | - | HPRD,BioGRID | 9312143 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
KEGG TYPE II DIABETES MELLITUS | 47 | 41 | All SZGR 2.0 genes in this pathway |
KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION | 42 | 29 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG IL4RECEPTOR IN B LYPHOCYTES | 27 | 23 | All SZGR 2.0 genes in this pathway |
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES | 51 | 41 | All SZGR 2.0 genes in this pathway |
PID IL4 2PATHWAY | 65 | 43 | All SZGR 2.0 genes in this pathway |
PID RET PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
PID IL2 1PATHWAY | 55 | 43 | All SZGR 2.0 genes in this pathway |
PID IGF1 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
PID EPO PATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME GROWTH HORMONE RECEPTOR SIGNALING | 24 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K AKT ACTIVATION | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNAL ATTENUATION | 14 | 8 | All SZGR 2.0 genes in this pathway |
REACTOME SOS MEDIATED SIGNALLING | 14 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP | 59 | 38 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER | 22 | 19 | All SZGR 2.0 genes in this pathway |
WANG METHYLATED IN BREAST CANCER | 35 | 25 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 120 HELA | 69 | 47 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 120 MCF10A | 65 | 44 | All SZGR 2.0 genes in this pathway |
JEON SMAD6 TARGETS DN | 19 | 14 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS DN | 66 | 39 | All SZGR 2.0 genes in this pathway |
KIM GERMINAL CENTER T HELPER DN | 24 | 15 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CHEN LVAD SUPPORT OF FAILING HEART UP | 103 | 69 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 1 | 33 | 24 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS DN | 120 | 81 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
MATZUK PREOVULATORY FOLLICLE | 10 | 8 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C CLUSTER DN | 32 | 21 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C DN | 59 | 39 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 | 68 | 50 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS EARLY UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS DN | 213 | 127 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 453 | 460 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-129-5p | 1543 | 1549 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-135 | 2426 | 2432 | 1A | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-141/200a | 2207 | 2213 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-153 | 2431 | 2437 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
hsa-miR-153 | UUGCAUAGUCACAAAAGUGA | ||||
miR-181 | 1644 | 1651 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-203.1 | 2025 | 2032 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-208 | 1556 | 1562 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-224 | 2151 | 2157 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-25/32/92/363/367 | 2045 | 2051 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA | ||||
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-30-5p | 2069 | 2075 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-33 | 1578 | 1585 | 1A,m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-448 | 2430 | 2437 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU | ||||
miR-496 | 1647 | 1653 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-499 | 1556 | 1562 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-7 | 2307 | 2314 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.