Gene Page: ZRANB2
Summary ?
| GeneID | 9406 |
| Symbol | ZRANB2 |
| Synonyms | ZIS|ZIS1|ZIS2|ZNF265 |
| Description | zinc finger RANBP2-type containing 2 |
| Reference | MIM:604347|HGNC:HGNC:13058|Ensembl:ENSG00000132485|HPRD:09185|Vega:OTTHUMG00000009660 |
| Gene type | protein-coding |
| Map location | 1p31 |
| Pascal p-value | 0.125 |
| Sherlock p-value | 0.788 |
| Fetal beta | 0.204 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| IFI27 | 0.84 | 0.88 |
| CST3 | 0.81 | 0.88 |
| PLA2G5 | 0.81 | 0.88 |
| MT3 | 0.80 | 0.89 |
| PLAC9 | 0.79 | 0.83 |
| CLDN10 | 0.79 | 0.89 |
| METRN | 0.78 | 0.81 |
| AC044839.2 | 0.78 | 0.84 |
| FXYD1 | 0.78 | 0.87 |
| MYL3 | 0.78 | 0.84 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MCM3AP | -0.74 | -0.83 |
| RNASEN | -0.74 | -0.85 |
| UBE4B | -0.74 | -0.81 |
| COPG2 | -0.73 | -0.85 |
| HEATR5B | -0.73 | -0.82 |
| ANKRD17 | -0.73 | -0.79 |
| PDXDC1 | -0.73 | -0.81 |
| CSDE1 | -0.73 | -0.87 |
| C10orf76 | -0.73 | -0.82 |
| ZKSCAN5 | -0.73 | -0.84 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | TAS | 9931435 | |
| GO:0003723 | RNA binding | TAS | 9931435 | |
| GO:0005515 | protein binding | IPI | 17620599 | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006397 | mRNA processing | IEA | - | |
| GO:0008380 | RNA splicing | TAS | 9931435 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | TAS | 9931435 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC UP | 33 | 20 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC 24HR 5 DN | 59 | 35 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN HIGHEST EXPRESSION | 40 | 29 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G1 S | 147 | 76 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 528 | 534 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 527 | 534 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-135 | 179 | 186 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-139 | 1700 | 1707 | 1A,m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-19 | 1447 | 1453 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-203.1 | 1681 | 1687 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-30-5p | 1623 | 1629 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-33 | 1594 | 1600 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-496 | 1711 | 1717 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-500 | 104 | 110 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
| miR-539 | 1046 | 1053 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.