SZGR2

Summary ?

GeneID	9796
Symbol	PHYHIP
Synonyms	DYRK1AP3\|PAHX-AP\|PAHXAP1
Description	phytanoyl-CoA 2-hydroxylase interacting protein
Reference	MIM:608511\|HGNC:HGNC:16865\|Ensembl:ENSG00000168490\|HPRD:16345\|Vega:OTTHUMG00000163776
Gene type	protein-coding
Map location	8p21.3
Pascal p-value	0.38
Sherlock p-value	0.154
DEG p-value	DEG:Maycox_2009:CC_BA10_fold_change=-1.11:CC_BA10_disease_P=0.0217:HBB_BA9_fold_change=-1.24:HBB_BA9_disease_P=0.0007
Fetal beta	-3.125
DMG	1 (# studies)
eGene	Caudate basal ganglia Cerebellum Myers' cis & trans
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Maycox_2009	Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue	We included 51 genes whose expression changes are common between two schizophrenia cohorts.
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.031
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.03086
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.00057

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22102057	8	22084298	PHYHIP	7.25E-5	0.742	0.025	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4854166	chr2	3297005	PHYHIP	9796		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C1orf92	0.95	0.50
C3orf25	0.95	0.59
CCDC114	0.95	0.50
WDR93	0.94	0.56
WDR63	0.93	0.43
CCDC108	0.93	0.64
RIBC1	0.93	0.59
CCDC11	0.93	0.54
CCDC135	0.93	0.53
CCDC19	0.93	0.42

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CIDEA	-0.20	-0.24
NUAK1	-0.19	-0.19
RGS6	-0.18	-0.24
IER5L	-0.18	-0.18
ANKRD56	-0.17	-0.13
FBXW7	-0.17	-0.15
EMX1	-0.17	-0.22
KCNV1	-0.17	-0.10
LNX1	-0.17	-0.13
SLC26A4	-0.16	-0.14

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAI1	FLJ41988	brain-specific angiogenesis inhibitor 1	-	HPRD	11245925
C14orf1	ERG28 \| NET51	chromosome 14 open reading frame 1	Two-hybrid	BioGRID	16169070
C1orf156	AsTP2 \| MGC9084 \| RP1-117P20.4	chromosome 1 open reading frame 156	Two-hybrid	BioGRID	16169070
COPS6	CSN6 \| MOV34-34KD	COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)	Two-hybrid	BioGRID	16169070
DYRK1A	DYRK \| DYRK1 \| HP86 \| MNB \| MNBH	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	DYRK1A interacts with PAHX-AP1.	BIND	15694837
DYRK1A	DYRK \| DYRK1 \| HP86 \| MNB \| MNBH	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	-	HPRD	15694837
EEF1A1	CCS-3 \| CCS3 \| EEF-1 \| EEF1A \| EF-Tu \| EF1A \| FLJ25721 \| GRAF-1EF \| HNGC:16303 \| LENG7 \| MGC102687 \| MGC131894 \| MGC16224 \| PTI1 \| eEF1A-1	eukaryotic translation elongation factor 1 alpha 1	Two-hybrid	BioGRID	16169070
FAM131A	C3orf40 \| FLAT715 \| MGC21688 \| PRO1378	family with sequence similarity 131, member A	Two-hybrid	BioGRID	16169070
HDAC11	FLJ22237	histone deacetylase 11	Two-hybrid	BioGRID	16169070
MAGED4B	MGC3210 \| MGC88639	melanoma antigen family D, 4B	Two-hybrid	BioGRID	16169070
MED8	ARC32 \| MGC17544 \| MGC19641	mediator complex subunit 8	Two-hybrid	BioGRID	16169070
NDRG1	CAP43 \| CMT4D \| DRG1 \| GC4 \| HMSNL \| NDR1 \| NMSL \| PROXY1 \| RIT42 \| RTP \| TARG1 \| TDD5	N-myc downstream regulated 1	Two-hybrid	BioGRID	16169070
NDUFV3	CI-9KD	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa	Two-hybrid	BioGRID	16169070
PHYH	LN1 \| LNAP1 \| PAHX \| PHYH1 \| RD	phytanoyl-CoA 2-hydroxylase	-	HPRD	10686344
PNPLA2	1110001C14Rik \| ATGL \| DESNUTRIN \| DKFZp667M109 \| FP17548 \| PEDF-R \| TTS-2.2 \| TTS2	patatin-like phospholipase domain containing 2	Two-hybrid	BioGRID	16169070
PPIE	CYP-33 \| MGC111222 \| MGC3736	peptidylprolyl isomerase E (cyclophilin E)	Two-hybrid	BioGRID	16169070
PRMT5	HRMT1L5 \| IBP72 \| JBP1 \| SKB1 \| SKB1Hs	protein arginine methyltransferase 5	Two-hybrid	BioGRID	16169070
S100A13	-	S100 calcium binding protein A13	Two-hybrid	BioGRID	16169070
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
WDR89	C14orf150 \| MGC9907 \| MSTP050	WD repeat domain 89	Two-hybrid	BioGRID	16169070
ZZEF1	FLJ10821 \| FLJ23789 \| FLJ45574 \| KIAA0399 \| MGC166929 \| ZZZ4	zinc finger, ZZ-type with EF-hand domain 1	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
VANHARANTA UTERINE FIBROID DN	67	45	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3	206	108	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3	126	83	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3	137	85	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN	242	146	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	446	452	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	446	452	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-140	1612	1618	m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-185	82	88	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-299-5p	1611	1617	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PHYHIP