SZGR2

Summary ?

GeneID	9810
Symbol	RNF40
Synonyms	BRE1B\|RBP95\|STARING
Description	ring finger protein 40, E3 ubiquitin protein ligase
Reference	MIM:607700\|HGNC:HGNC:16867\|Ensembl:ENSG00000103549\|HPRD:07411\|Vega:OTTHUMG00000132394
Gene type	protein-coding
Map location	16p11.2-p11.1
Pascal p-value	0.052
Sherlock p-value	0.775
Fetal beta	-0.382
eGene	Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Nucleus accumbens basal ganglia Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01775
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10497672		0	RNF40	9810		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0016874	ligase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006511	ubiquitin-dependent protein catabolic process	IEA		-
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005694	chromosome	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS UP	19	12	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP	225	139	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR UP	111	68	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	863	869	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-125/351	9	15	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	9	15	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-331	11	17	1A	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA
miR-491	60	66	m8	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RNF40