Gene Page: RAB39A
Summary ?
| GeneID | 54734 |
| Symbol | RAB39A |
| Synonyms | RAB39 |
| Description | RAB39A, member RAS oncogene family |
| Reference | HGNC:HGNC:16521|Ensembl:ENSG00000179331|HPRD:11470|Vega:OTTHUMG00000166367 |
| Gene type | protein-coding |
| Map location | 11q22.3 |
| Pascal p-value | 0.132 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005525 | GTP binding | NAS | 9119394 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005886 | plasma membrane | IEA | - |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-495 | 243 | 249 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.