Gene Page: STMN4
Summary ?
GeneID | 81551 |
Symbol | STMN4 |
Synonyms | RB3 |
Description | stathmin 4 |
Reference | HGNC:HGNC:16078|Ensembl:ENSG00000015592|HPRD:18120|Vega:OTTHUMG00000099461 |
Gene type | protein-coding |
Map location | 8p21.2 |
Pascal p-value | 0.043 |
Sherlock p-value | 0.622 |
Fetal beta | 0.592 |
eGene | Caudate basal ganglia Cortex Hippocampus Nucleus accumbens basal ganglia Putamen basal ganglia Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1562330 | 8 | 27098436 | STMN4 | ENSG00000015592.12 | 2.57902E-15 | 0 | 17501 | gtex_brain_putamen_basal |
rs17366947 | 8 | 27103024 | STMN4 | ENSG00000015592.12 | 2.57902E-15 | 0 | 12913 | gtex_brain_putamen_basal |
rs10481349 | 8 | 27104727 | STMN4 | ENSG00000015592.12 | 2.51219E-15 | 0 | 11210 | gtex_brain_putamen_basal |
rs28407392 | 8 | 27117727 | STMN4 | ENSG00000015592.12 | 1.25788E-11 | 0 | -1790 | gtex_brain_putamen_basal |
rs62502378 | 8 | 27119012 | STMN4 | ENSG00000015592.12 | 1.79266E-6 | 0 | -3075 | gtex_brain_putamen_basal |
rs1345134 | 8 | 27119538 | STMN4 | ENSG00000015592.12 | 2.52833E-6 | 0 | -3601 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0007242 | intracellular signaling cascade | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 173 | 179 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-150 | 210 | 216 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-433-3p | 522 | 528 | m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.