Gene Page: PIGK
Summary ?
| GeneID | 10026 |
| Symbol | PIGK |
| Synonyms | GPI8 |
| Description | phosphatidylinositol glycan anchor biosynthesis class K |
| Reference | MIM:605087|HGNC:HGNC:8965|Ensembl:ENSG00000142892|HPRD:05474|Vega:OTTHUMG00000009686 |
| Gene type | protein-coding |
| Map location | 1p31.1 |
| Pascal p-value | 0.344 |
| Sherlock p-value | 0.758 |
| Fetal beta | -1.031 |
| DMG | 2 (# studies) |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg12655452 | 1 | 77685094 | PIGK | 4.86E-5 | -0.432 | 0.021 | DMG:Wockner_2014 |
| cg18299211 | 1 | 77685015 | PIGK | 5.64E-8 | -0.012 | 1.45E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KIAA0174 | 0.86 | 0.86 |
| HEATR6 | 0.86 | 0.86 |
| STT3A | 0.85 | 0.86 |
| C9orf64 | 0.85 | 0.85 |
| PRPSAP1 | 0.85 | 0.86 |
| CAPN7 | 0.84 | 0.85 |
| TSR1 | 0.84 | 0.84 |
| C17orf71 | 0.84 | 0.85 |
| PPP1R8 | 0.84 | 0.86 |
| RSPRY1 | 0.84 | 0.85 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.71 | -0.79 |
| AF347015.31 | -0.70 | -0.78 |
| MT-CYB | -0.67 | -0.76 |
| AF347015.27 | -0.67 | -0.76 |
| AF347015.8 | -0.67 | -0.77 |
| AF347015.21 | -0.67 | -0.80 |
| AF347015.33 | -0.66 | -0.74 |
| IFI27 | -0.65 | -0.72 |
| AF347015.2 | -0.63 | -0.76 |
| C5orf53 | -0.63 | -0.66 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003923 | GPI-anchor transamidase activity | IMP | 10793132 | |
| GO:0005515 | protein binding | IPI | 10793132 |11483512 | |
| GO:0004197 | cysteine-type endopeptidase activity | IEA | - | |
| GO:0008233 | peptidase activity | IEA | - | |
| GO:0034235 | GPI anchor binding | TAS | 10793132 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006467 | protein thiol-disulfide exchange | TAS | 12582175 | |
| GO:0006508 | proteolysis | IEA | - | |
| GO:0016255 | attachment of GPI anchor to protein | EXP | 1846368 | |
| GO:0016255 | attachment of GPI anchor to protein | TAS | 11483512 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0042765 | GPI-anchor transamidase complex | IMP | 10793132 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOSYLPHOSPHATIDYLINOSITOL GPI ANCHOR BIOSYNTHESIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
| REACTOME POST TRANSLATIONAL MODIFICATION SYNTHESIS OF GPI ANCHORED PROTEINS | 26 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION | 188 | 116 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| WILLIAMS ESR2 TARGETS UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA DN | 100 | 63 | All SZGR 2.0 genes in this pathway |
| ELLWOOD MYC TARGETS UP | 13 | 8 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-410 | 2701 | 2707 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.