Gene Page: SORBS3
Summary ?
| GeneID | 10174 |
| Symbol | SORBS3 |
| Synonyms | SCAM-1|SCAM1|SH3D4 |
| Description | sorbin and SH3 domain containing 3 |
| Reference | MIM:610795|HGNC:HGNC:30907|Ensembl:ENSG00000120896|HPRD:11535|Vega:OTTHUMG00000131728 |
| Gene type | protein-coding |
| Map location | 8p21.3 |
| Pascal p-value | 0.006 |
| Sherlock p-value | 0.291 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.024 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9878437 | chr3 | 60321270 | SORBS3 | 10174 | 0.19 | trans | ||
| rs16955618 | chr15 | 29937543 | SORBS3 | 10174 | 0 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| EBF1 | 0.96 | 0.46 |
| PBX3 | 0.92 | 0.52 |
| NTN1 | 0.90 | 0.51 |
| ZNF503 | 0.89 | 0.46 |
| C10orf41 | 0.89 | 0.31 |
| RARB | 0.88 | 0.37 |
| AC010997.1 | 0.88 | 0.46 |
| ZNF521 | 0.88 | 0.55 |
| AC134043.1 | 0.87 | 0.22 |
| SERTAD4 | 0.87 | 0.47 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CDADC1 | -0.21 | 0.07 |
| CHPT1 | -0.21 | -0.12 |
| INPP1 | -0.21 | -0.01 |
| C5orf53 | -0.18 | -0.30 |
| PTH1R | -0.18 | -0.21 |
| C1S | -0.18 | 0.03 |
| TMEM54 | -0.17 | -0.13 |
| PPP2R5A | -0.17 | 0.17 |
| COPZ2 | -0.17 | -0.25 |
| BLVRB | -0.17 | -0.04 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005200 | structural constituent of cytoskeleton | TAS | 9885244 | |
| GO:0008134 | transcription factor binding | IEA | - | |
| GO:0017166 | vinculin binding | IPI | 9885244 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IEA | - | |
| GO:0031589 | cell-substrate adhesion | IEA | - | |
| GO:0043410 | positive regulation of MAPKKK cascade | IEA | - | |
| GO:0051495 | positive regulation of cytoskeleton organization | NAS | 9885244 | |
| GO:0051496 | positive regulation of stress fiber formation | IDA | 9885244 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005856 | cytoskeleton | IEA | - | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005925 | focal adhesion | IDA | 9885244 | |
| GO:0005925 | focal adhesion | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ADAMTSL4 | TSRC1 | ADAMTS-like 4 | Two-hybrid | BioGRID | 16189514 |
| CBLB | DKFZp686J10223 | DKFZp779A0729 | DKFZp779F1443 | FLJ36865 | FLJ41152 | Nbla00127 | RNF56 | Cas-Br-M (murine) ecotropic retroviral transforming sequence b | Two-hybrid | BioGRID | 16189514 |
| DDX17 | DKFZp761H2016 | P72 | RH70 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 | Two-hybrid | BioGRID | 16189514 |
| DLG5 | KIAA0583 | LP-DLG | P-DLG5 | PDLG | discs, large homolog 5 (Drosophila) | - | HPRD,BioGRID | 12657639 |
| DMRTB1 | - | DMRT-like family B with proline-rich C-terminal, 1 | Two-hybrid | BioGRID | 16189514 |
| DVL2 | - | dishevelled, dsh homolog 2 (Drosophila) | Two-hybrid | BioGRID | 16189514 |
| EFS | CAS3 | CASS3 | EFS1 | EFS2 | HEFS | SIN | embryonal Fyn-associated substrate | Two-hybrid | BioGRID | 16189514 |
| FLJ12529 | FLJ39024 | MGC9315 | pre-mRNA cleavage factor I, 59 kDa subunit | Two-hybrid | BioGRID | 16189514 |
| FLOT1 | - | flotillin 1 | Reconstituted Complex | BioGRID | 11481476 |
| HNRNPK | CSBP | FLJ41122 | HNRPK | TUNP | heterogeneous nuclear ribonucleoprotein K | Two-hybrid | BioGRID | 16189514 |
| KIAA0408 | FLJ43995 | RP3-403A15.2 | KIAA0408 | Two-hybrid | BioGRID | 16189514 |
| KIAA1217 | DKFZp761L0424 | MGC31990 | SKT | KIAA1217 | Two-hybrid | BioGRID | 16189514 |
| MAPK1 | ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk | mitogen-activated protein kinase 1 | Affinity Capture-Western Biochemical Activity | BioGRID | 15184391 |
| MAPK3 | ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 | mitogen-activated protein kinase 3 | - | HPRD | 15184391 |
| RBMX | HNRPG | RBMXP1 | RBMXRT | RNMX | hnRNP-G | RNA binding motif protein, X-linked | Two-hybrid | BioGRID | 16189514 |
| SAFB2 | KIAA0138 | scaffold attachment factor B2 | - | HPRD,BioGRID | 12660241 |
| ZBED1 | ALTE | DREF | KIAA0785 | TRAMP | hDREF | zinc finger, BED-type containing 1 | Two-hybrid | BioGRID | 16189514 |
| ZBTB25 | KUP | ZNF46 | zinc finger and BTB domain containing 25 | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME MUSCLE CONTRACTION | 48 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME SMOOTH MUSCLE CONTRACTION | 25 | 14 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
| AMIT SERUM RESPONSE 20 MCF10A | 21 | 10 | All SZGR 2.0 genes in this pathway |
| LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| NADLER HYPERGLYCEMIA AT OBESITY | 58 | 35 | All SZGR 2.0 genes in this pathway |
| PARK HSC AND MULTIPOTENT PROGENITORS | 50 | 33 | All SZGR 2.0 genes in this pathway |
| LOPES METHYLATED IN COLON CANCER DN | 28 | 26 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 10 | 33 | 22 | All SZGR 2.0 genes in this pathway |
| VALK AML WITH EVI1 | 25 | 15 | All SZGR 2.0 genes in this pathway |
| DASU IL6 SIGNALING UP | 59 | 44 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-9 | 407 | 413 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.