SZGR2

Summary ?

GeneID	10217
Symbol	CTDSPL
Synonyms	C3orf8\|HYA22\|PSR1\|RBSP3\|SCP3
Description	CTD small phosphatase like
Reference	MIM:608592\|HGNC:HGNC:16890\|Ensembl:ENSG00000144677\|Vega:OTTHUMG00000155942
Gene type	protein-coding
Map location	3p21.3
Pascal p-value	0.001
Sherlock p-value	0.864

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.006

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0004721	phosphoprotein phosphatase activity	IEA		-
GO:0016787	hydrolase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008150	biological_process	ND		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID SMAD2 3PATHWAY	17	13	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS DN	182	111	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL DN	86	59	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP	204	140	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN	136	94	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
LIN APC TARGETS	77	55	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP	131	87	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP	182	119	All SZGR 2.0 genes in this pathway
SU PANCREAS	54	30	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION	88	65	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D CLUSTER DN	40	26	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D DN	78	34	All SZGR 2.0 genes in this pathway
FLOTHO PEDIATRIC ALL THERAPY RESPONSE UP	53	33	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
NIELSEN GIST	98	66	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
GREGORY SYNTHETIC LETHAL WITH IMATINIB	145	83	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	1099	1105	m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	1099	1105	m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-124.1	1958	1965	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	398	404	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	1051	1057	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1051	1057	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-137	2475	2482	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-15/16/195/424/497	992	999	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-18	2342	2349	1A,m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	2342	2349	1A,m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-181	406	412	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
				hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	3576	3582	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-183	2624	2631	1A,m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-218	1351	1357	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-339	1098	1104	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-493-5p	2401	2407	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-503	993	999	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG
miR-504	1100	1107	1A,m8	hsa-miR-504	AGACCCUGGUCUGCACUCUAU
miR-505	1999	2005	m8	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-543	2513	2519	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-543	2513	2519	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-96	3576	3582	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC
miR-99/100	2545	2552	1A,m8	hsa-miR-99a^brain	AACCCGUAGAUCCGAUCUUGUG
				hsa-miR-100^brain	AACCCGUAGAUCCGAACUUGUG
				hsa-miR-99b^brain	CACCCGUAGAACCGACCUUGCG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CTDSPL