Gene Page: IKZF1
Summary ?
GeneID | 10320 |
Symbol | IKZF1 |
Synonyms | Hs.54452|IK1|IKAROS|LYF1|LyF-1|PPP1R92|PRO0758|ZNFN1A1 |
Description | IKAROS family zinc finger 1 |
Reference | MIM:603023|HGNC:HGNC:13176|Ensembl:ENSG00000185811|HPRD:04318|Vega:OTTHUMG00000155907 |
Gene type | protein-coding |
Map location | 7p12.2 |
Pascal p-value | 0.137 |
DEG p-value | DEG:Sanders_2014:DS1_p=-0.147:DS1_beta=0.049300:DS2_p=2.85e-03:DS2_beta=0.151:DS2_FDR=3.28e-02 |
Fetal beta | -0.412 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg08072980 | 7 | 50450320 | IKZF1 | 5.35E-6 | 0.488 | 0.011 | DMG:Wockner_2014 |
cg27633530 | 7 | 50344294 | IKZF1 | 2.161E-4 | -0.293 | 0.036 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NDUFA2 | 0.93 | 0.83 |
MRPL54 | 0.92 | 0.83 |
NDUFB7 | 0.91 | 0.81 |
C19orf70 | 0.91 | 0.78 |
NDUFA11 | 0.91 | 0.87 |
UQCRQ | 0.90 | 0.80 |
UQCR | 0.90 | 0.77 |
ZNF593 | 0.90 | 0.71 |
LSMD1 | 0.89 | 0.76 |
AC009171.1 | 0.89 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KIF16B | -0.49 | -0.55 |
CCDC55 | -0.48 | -0.52 |
MYH9 | -0.47 | -0.46 |
GOLGB1 | -0.47 | -0.48 |
GOLGA4 | -0.46 | -0.48 |
BAT2D1 | -0.46 | -0.45 |
FNBP1 | -0.46 | -0.52 |
MPHOSPH8 | -0.46 | -0.44 |
Z83840.4 | -0.45 | -0.58 |
DST | -0.45 | -0.51 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0016564 | transcription repressor activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007498 | mesoderm development | TAS | 8543809 | |
GO:0016481 | negative regulation of transcription | IEA | - | |
GO:0040018 | positive regulation of multicellular organism growth | IEA | - | |
GO:0048732 | gland development | IEA | - | |
GO:0030097 | hemopoiesis | IEA | - | |
GO:0045941 | positive regulation of transcription | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005721 | centromeric heterochromatin | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AP2M1 | AP50 | CLAPM1 | mu2 | adaptor-related protein complex 2, mu 1 subunit | Two-hybrid | BioGRID | 16189514 |
CHD3 | Mi-2a | Mi2-ALPHA | ZFH | chromodomain helicase DNA binding protein 3 | - | HPRD | 10204490 |
CHD4 | DKFZp686E06161 | Mi-2b | Mi2-BETA | chromodomain helicase DNA binding protein 4 | Affinity Capture-Western | BioGRID | 12015313 |
CTBP1 | BARS | MGC104684 | C-terminal binding protein 1 | - | HPRD,BioGRID | 10766745 |
GTF2B | TF2B | TFIIB | general transcription factor IIB | Reconstituted Complex | BioGRID | 11959865 |
HDAC1 | DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 | histone deacetylase 1 | Affinity Capture-Western | BioGRID | 10357820 |12015313 |
HDAC2 | RPD3 | YAF1 | histone deacetylase 2 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC3 | HD3 | RPD3 | RPD3-2 | histone deacetylase 3 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC5 | FLJ90614 | HD5 | NY-CO-9 | histone deacetylase 5 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC7 | DKFZp586J0917 | FLJ99588 | HD7A | HDAC7A | histone deacetylase 7 | Affinity Capture-Western | BioGRID | 12015313 |
IKZF2 | HELIOS | MGC34330 | ZNF1A2 | ZNFN1A2 | IKAROS family zinc finger 2 (Helios) | - | HPRD,BioGRID | 9560339 |
IKZF3 | AIO | AIOLOS | ZNFN1A3 | IKAROS family zinc finger 3 (Aiolos) | - | HPRD | 9155026 |
IKZF4 | EOS | KIAA1782 | ZNFN1A4 | IKAROS family zinc finger 4 (Eos) | - | HPRD,BioGRID | 10218586 |10978333 |
IKZF5 | DKFZp781B0249 | FLJ22973 | PEGASUS | ZNFN1A5 | IKAROS family zinc finger 5 (Pegasus) | Reconstituted Complex Two-hybrid | BioGRID | 10978333 |
NCOR2 | CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1 | nuclear receptor co-repressor 2 | Affinity Capture-Western | BioGRID | 11959865 |
RBBP8 | CTIP | RIM | retinoblastoma binding protein 8 | - | HPRD,BioGRID | 11959865 |
SIN3A | DKFZp434K2235 | FLJ90319 | KIAA0700 | SIN3 homolog A, transcription regulator (yeast) | Affinity Capture-Western | BioGRID | 10357820 |11959865 |12015313 |
SIN3A | DKFZp434K2235 | FLJ90319 | KIAA0700 | SIN3 homolog A, transcription regulator (yeast) | - | HPRD | 10357820 |12015313 |
SIN3B | KIAA0700 | SIN3 homolog B, transcription regulator (yeast) | - | HPRD,BioGRID | 10357820 |12015313 |
TBP | GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID | TATA box binding protein | - | HPRD,BioGRID | 11959865 |
UBE2I | C358B7.1 | P18 | UBC9 | ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID NFAT TFPATHWAY | 47 | 39 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA DN | 52 | 30 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP | 175 | 108 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
MAYBURD RESPONSE TO L663536 UP | 29 | 18 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES DN | 16 | 10 | All SZGR 2.0 genes in this pathway |
KLEIN TARGETS OF BCR ABL1 FUSION | 45 | 34 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 29 | 11 | 7 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
GOERING BLOOD HDL CHOLESTEROL QTL CIS | 13 | 7 | All SZGR 2.0 genes in this pathway |
BYSTROEM CORRELATED WITH IL5 DN | 64 | 47 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 3476 | 3483 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-137 | 3322 | 3328 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-153 | 3505 | 3511 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-218 | 45 | 52 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-25/32/92/363/367 | 3507 | 3513 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-27 | 3477 | 3484 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-448 | 3504 | 3511 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.