Gene Page: USP39
Summary ?
| GeneID | 10713 |
| Symbol | USP39 |
| Synonyms | 65K|CGI-21|HSPC332|SAD1|SNRNP65 |
| Description | ubiquitin specific peptidase 39 |
| Reference | MIM:611594|HGNC:HGNC:20071|Ensembl:ENSG00000168883|HPRD:07165|Vega:OTTHUMG00000153090 |
| Gene type | protein-coding |
| Map location | 2p11.2 |
| Pascal p-value | 0.095 |
| Sherlock p-value | 0.214 |
| Fetal beta | 0.87 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0004 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| ch.2.1892000F | 2 | 85858578 | USP39 | 2.373E-4 | -0.168 | 0.037 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SASH3 | 0.58 | 0.48 |
| CD68 | 0.55 | 0.47 |
| HCK | 0.55 | 0.46 |
| SYK | 0.53 | 0.46 |
| FOLR2 | 0.52 | 0.41 |
| NCKAP1L | 0.52 | 0.48 |
| ITGB2 | 0.51 | 0.49 |
| CYTH4 | 0.49 | 0.44 |
| SIGLEC7 | 0.48 | 0.34 |
| CD37 | 0.48 | 0.43 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.18 | -0.19 | -0.17 |
| MT-CO2 | -0.18 | -0.15 |
| AC010300.1 | -0.18 | -0.15 |
| NOSTRIN | -0.18 | -0.12 |
| EDN1 | -0.17 | -0.06 |
| CXCL2 | -0.17 | -0.13 |
| ANP32C | -0.17 | -0.12 |
| F2RL3 | -0.17 | -0.08 |
| IL32 | -0.16 | -0.13 |
| AF347015.26 | -0.16 | -0.13 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0004221 | ubiquitin thiolesterase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000245 | spliceosome assembly | TAS | 10022888 | |
| GO:0006397 | mRNA processing | TAS | 10022888 | |
| GO:0008380 | RNA splicing | TAS | 10022888 | |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
| NAKAMURA CANCER MICROENVIRONMENT DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| WONG PROTEASOME GENE MODULE | 49 | 35 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K9ME3 DN | 120 | 71 | All SZGR 2.0 genes in this pathway |
| KUROKAWA LIVER CANCER EARLY RECURRENCE UP | 12 | 9 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-299-5p | 469 | 475 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.