Gene Page: SRCAP
Summary ?
| GeneID | 10847 |
| Symbol | SRCAP |
| Synonyms | DOMO1|EAF1|FLHS|SWR1 |
| Description | Snf2-related CREBBP activator protein |
| Reference | MIM:611421|HGNC:HGNC:16974|Ensembl:ENSG00000080603|HPRD:18103|Vega:OTTHUMG00000132393 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 0.041 |
| eGene | Myers' cis & trans |
| Support | Chromatin Remodeling Genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| snp_a-2162733 | 0 | SRCAP | 10847 | 0.14 | trans | |||
| rs9933246 | chr16 | 7497701 | SRCAP | 10847 | 0.15 | trans | ||
| rs9935962 | chr16 | 7504669 | SRCAP | 10847 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RGS6 | 0.45 | 0.43 |
| LRRTM4 | 0.44 | 0.44 |
| PDE1A | 0.44 | 0.43 |
| GALNT13 | 0.43 | 0.36 |
| KCNJ6 | 0.43 | 0.38 |
| BRAF | 0.42 | 0.43 |
| SH3GL2 | 0.42 | 0.42 |
| DOK6 | 0.42 | 0.40 |
| C6orf142 | 0.42 | 0.43 |
| ITGA11 | 0.42 | 0.42 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| VEGFB | -0.35 | -0.32 |
| RHOC | -0.34 | -0.40 |
| EFEMP2 | -0.33 | -0.28 |
| RAB34 | -0.30 | -0.32 |
| GATSL3 | -0.30 | -0.31 |
| C19orf36 | -0.29 | -0.30 |
| SERPINB6 | -0.29 | -0.33 |
| S100A16 | -0.28 | -0.34 |
| SLC2A4RG | -0.28 | -0.30 |
| NUDT8 | -0.28 | -0.27 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003713 | transcription coactivator activity | TAS | 10347196 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004386 | helicase activity | IEA | - | |
| GO:0004402 | histone acetyltransferase activity | TAS | 10347196 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 10347196 | |
| GO:0006350 | transcription | IEA | - | |
| GO:0016568 | chromatin modification | IEA | - | |
| GO:0044419 | interspecies interaction between organisms | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| FOURNIER ACINAR DEVELOPMENT EARLY UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
| COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| ZUCCHI METASTASIS UP | 43 | 24 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
| PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2 | 76 | 45 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 217 | 224 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-26 | 74 | 81 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC | ||||
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-324-3p | 215 | 221 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-491 | 246 | 252 | m8 | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
| miR-9 | 135 | 141 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.