Gene Page: SOX30
Summary ?
GeneID | 11063 |
Symbol | SOX30 |
Synonyms | - |
Description | SRY-box 30 |
Reference | MIM:606698|HGNC:HGNC:30635|Ensembl:ENSG00000039600|HPRD:09461|Vega:OTTHUMG00000130247 |
Gene type | protein-coding |
Map location | 5q33 |
Pascal p-value | 0.751 |
Fetal beta | -0.91 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HOOI ST7 TARGETS UP | 94 | 57 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
WEBER METHYLATED HCP IN FIBROBLAST DN | 42 | 22 | All SZGR 2.0 genes in this pathway |
WEBER METHYLATED HCP IN SPERM DN | 28 | 13 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-203.1 | 29 | 35 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-374 | 504 | 510 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.