SZGR2

Summary ?

GeneID	1107
Symbol	CHD3
Synonyms	Mi-2a\|Mi2-ALPHA\|ZFH
Description	chromodomain helicase DNA binding protein 3
Reference	MIM:602120\|HGNC:HGNC:1918\|Ensembl:ENSG00000170004\|HPRD:09071\|Vega:OTTHUMG00000150427
Gene type	protein-coding
Map location	17p13.1
Pascal p-value	0.015
Fetal beta	0.846
DMG	1 (# studies)
Support	CompositeSet Darnell FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0278

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg00066663	17	7792674	CHD3	4.38E-5	-0.004	0.091	DMG:Montano_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003677	DNA binding	TAS		9326634
GO:0003682	chromatin binding	IEA		-
GO:0004003	ATP-dependent DNA helicase activity	TAS		9326634
GO:0005515	protein binding	IPI		12505151 \|15383276
GO:0005524	ATP binding	IEA		-
GO:0016787	hydrolase activity	IEA		-
GO:0016818	hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides	IEA		-
GO:0008270	zinc ion binding	NAS		9688266
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006333	chromatin assembly or disassembly	IEA		-
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		9326634
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000785	chromatin	IEA		-
GO:0005634	nucleus	NAS		9688266

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADH5	ADH-3 \| ADHX \| FDH \| GSNOR	alcohol dehydrogenase 5 (class III), chi polypeptide	Two-hybrid	BioGRID	16169070
ARS2	ASR2 \| MGC126427	arsenate resistance protein 2	Two-hybrid	BioGRID	16169070
ATPIF1	ATPI \| ATPIP \| IP \| MGC1167 \| MGC8898	ATPase inhibitory factor 1	Two-hybrid	BioGRID	16169070
BCL6	BCL5 \| BCL6A \| LAZ3 \| ZBTB27 \| ZNF51	B-cell CLL/lymphoma 6	BCL6 interacts with Mi2.	BIND	15454082
BHLHB2	DEC1 \| SHARP-2 \| STRA13 \| Stra14 \| bHLHe40	basic helix-loop-helix domain containing, class B, 2	Two-hybrid	BioGRID	16169070
C4orf17	DKFZp434G072	chromosome 4 open reading frame 17	Two-hybrid	BioGRID	16169070
C7orf36	GK003	chromosome 7 open reading frame 36	Two-hybrid	BioGRID	16169070
CASP6	MCH2	caspase 6, apoptosis-related cysteine peptidase	Two-hybrid	BioGRID	16169070
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Two-hybrid	BioGRID	16169070
CPE	-	carboxypeptidase E	Two-hybrid	BioGRID	16169070
CRCT1	C1orf42 \| NICE-1	cysteine-rich C-terminal 1	Two-hybrid	BioGRID	16169070
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	Two-hybrid	BioGRID	16169070
CSTF2	CstF-64	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	Two-hybrid	BioGRID	16169070
CTTN	EMS1 \| FLJ34459	cortactin	Two-hybrid	BioGRID	16169070
FAM134A	C2orf17 \| DKFZp686C2379 \| MGC3035	family with sequence similarity 134, member A	Two-hybrid	BioGRID	16169070
FBP2	MGC142192	fructose-1,6-bisphosphatase 2	Two-hybrid	BioGRID	16169070
FUBP1	FBP \| FUBP	far upstream element (FUSE) binding protein 1	Two-hybrid	BioGRID	16169070
GPS2	AMF-1 \| MGC104294 \| MGC119287 \| MGC119288 \| MGC119289	G protein pathway suppressor 2	Two-hybrid	BioGRID	16169070
HABP4	IHABP4 \| Ki-1/57 \| MGC825 \| SERBP1L	hyaluronan binding protein 4	-	HPRD,BioGRID	12505151
HABP4	IHABP4 \| Ki-1/57 \| MGC825 \| SERBP1L	hyaluronan binding protein 4	Ki-1/57 interacts with CHD-3.	BIND	12505151
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	9804427
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	9804427
HSPH1	DKFZp686M05240 \| HSP105 \| HSP105A \| HSP105B \| KIAA0201 \| NY-CO-25	heat shock 105kDa/110kDa protein 1	Two-hybrid	BioGRID	16169070
IK	CSA2 \| MGC59741 \| RED	IK cytokine, down-regulator of HLA II	Two-hybrid	BioGRID	16169070
IKZF1	Hs.54452 \| IK1 \| IKAROS \| LYF1 \| PRO0758 \| ZNFN1A1 \| hIk-1	IKAROS family zinc finger 1 (Ikaros)	-	HPRD	10204490
IKZF3	AIO \| AIOLOS \| ZNFN1A3	IKAROS family zinc finger 3 (Aiolos)	-	HPRD	10204490
IMMT	DKFZp779P1653 \| HMP \| MGC111146 \| P87 \| P87/89 \| P89 \| PIG4 \| PIG52	inner membrane protein, mitochondrial (mitofilin)	Two-hybrid	BioGRID	16169070
IVNS1ABP	DKFZp686K06216 \| FLARA3 \| FLJ10069 \| FLJ10411 \| FLJ10962 \| FLJ35593 \| FLJ36593 \| HSPC068 \| KIAA0850 \| ND1 \| NS-1 \| NS1-BP \| NS1BP	influenza virus NS1A binding protein	Two-hybrid	BioGRID	16169070
KIF15	FLJ25667 \| HKLP2 \| KNSL7 \| NY-BR-62	kinesin family member 15	Two-hybrid	BioGRID	16169070
LUC7L2	CGI-59 \| CGI-74 \| FLJ10657 \| LUC7B2	LUC7-like 2 (S. cerevisiae)	Two-hybrid	BioGRID	16169070
MAFG	MGC13090 \| MGC20149	v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)	Two-hybrid	BioGRID	16169070
MAN2A2	MANA2X	mannosidase, alpha, class 2A, member 2	Two-hybrid	BioGRID	16169070
MBD2	DKFZp586O0821 \| DMTase \| NY-CO-41	methyl-CpG binding domain protein 2	Reconstituted Complex	BioGRID	10444591
MBD3L1	MBD3L \| MGC138263 \| MGC138269	methyl-CpG binding domain protein 3-like 1	Affinity Capture-Western	BioGRID	15456747
MTA2	DKFZp686F2281 \| MTA1L1 \| PID	metastasis associated 1 family, member 2	Co-purification	BioGRID	10444591
PAICS	ADE2 \| ADE2H1 \| AIRC \| DKFZp781N1372 \| MGC1343 \| MGC5024 \| PAIS	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	Two-hybrid	BioGRID	16169070
PCMT1	-	protein-L-isoaspartate (D-aspartate) O-methyltransferase	Two-hybrid	BioGRID	16169070
PRG2	BMPG \| MBP \| MBP1 \| MGC14537	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	Two-hybrid	BioGRID	16169070
PRPF40A	FBP-11 \| FBP11 \| FLAF1 \| FLJ20585 \| FNBP3 \| HIP10 \| HYPA \| NY-REN-6	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	-	HPRD	15383276
PSME1	IFI5111 \| MGC8628 \| PA28A \| PA28alpha \| REGalpha	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	Two-hybrid	BioGRID	16169070
PTN	HARP \| HBGF8 \| HBNF \| NEGF1	pleiotrophin	Two-hybrid	BioGRID	16169070
PTPRS	PTPSIGMA	protein tyrosine phosphatase, receptor type, S	Two-hybrid	BioGRID	16169070
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	Two-hybrid	BioGRID	16169070
RAD21	FLJ25655 \| FLJ40596 \| HR21 \| HRAD21 \| KIAA0078 \| MCD1 \| NXP1 \| SCC1 \| hHR21	RAD21 homolog (S. pombe)	Co-purification	BioGRID	12198550
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	Two-hybrid	BioGRID	16169070
RPL29	HIP \| HUMRPL29 \| MGC88589	ribosomal protein L29	Two-hybrid	BioGRID	16169070
SAFB	DKFZp779C1727 \| HAP \| HET \| SAFB1	scaffold attachment factor B	Two-hybrid	BioGRID	16169070
SAT1	DC21 \| KFSD \| SAT \| SSAT \| SSAT-1	spermidine/spermine N1-acetyltransferase 1	Two-hybrid	BioGRID	16169070
SATB1	-	SATB homeobox 1	-	HPRD	12374985
SDCCAG3	NY-CO-3	serologically defined colon cancer antigen 3	Two-hybrid	BioGRID	16169070
SERBP1	CGI-55 \| CHD3IP \| DKFZp564M2423 \| FLJ90489 \| HABP4L \| PAI-RBP1 \| PAIRBP1	SERPINE1 mRNA binding protein 1	-	HPRD,BioGRID	12505151
SERBP1	CGI-55 \| CHD3IP \| DKFZp564M2423 \| FLJ90489 \| HABP4L \| PAI-RBP1 \| PAIRBP1	SERPINE1 mRNA binding protein 1	CGI-55 interacts with CHD-3.	BIND	12505151
SERF2	4F5REL \| FAM2C \| FLJ20431 \| FLJ37527 \| FLJ38557 \| H4F5rel \| HsT17089 \| MGC48826	small EDRK-rich factor 2	Two-hybrid	BioGRID	16169070
SGSM2	KIAA0397 \| RUTBC1	small G protein signaling modulator 2	Two-hybrid	BioGRID	16169070
SIRT6	SIR2L6	sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)	Two-hybrid	BioGRID	16169070
SLC27A6	ACSVL2 \| DKFZp779M0564 \| FACVL2 \| FATP6 \| VLCS-H1	solute carrier family 27 (fatty acid transporter), member 6	Two-hybrid	BioGRID	16169070
SMARCA5	ISWI \| SNF2H \| WCRF135 \| hISWI \| hSNF2H	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	Co-purification	BioGRID	12198550
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	SUMO-1 interacts with CHD3.	BIND	14609633
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	-	HPRD	14609633
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	Two-hybrid	BioGRID	10961991
SUMO2	HSMT3 \| MGC117191 \| SMT3B \| SMT3H2	SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)	Two-hybrid	BioGRID	16169070
THOC7	FLJ23445 \| NIF3L1BP1 \| fSAP24	THO complex 7 homolog (Drosophila)	Two-hybrid	BioGRID	16169070
TNFRSF14	ATAR \| HVEA \| HVEM \| LIGHTR \| TR2	tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)	Two-hybrid	BioGRID	16169070
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10961991
TP73	P73	tumor protein p73	-	HPRD,BioGRID	10961991
TRIM28	FLJ29029 \| KAP1 \| RNF96 \| TF1B \| TIF1B	tripartite motif-containing 28	Two-hybrid	BioGRID	16169070
TSPAN6	T245 \| TM4SF6 \| TSPAN-6	tetraspanin 6	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
TXNDC9	APACD	thioredoxin domain containing 9	Two-hybrid	BioGRID	16169070
UBA3	DKFZp566J164 \| MGC22384 \| UBE1C \| hUBA3	ubiquitin-like modifier activating enzyme 3	Two-hybrid	BioGRID	16169070
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	-	HPRD,BioGRID	14609633
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Ubc9 interacts with CHD3.	BIND	14609633
XRCC4	-	X-ray repair complementing defective repair in Chinese hamster cells 4	Two-hybrid	BioGRID	16169070
ZHX1	-	zinc fingers and homeoboxes 1	-	HPRD	15383276

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID HDAC CLASSI PATHWAY	66	50	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN	57	45	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN	46	30	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-491	90	96	m8	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA
miR-504	252	258	m8	hsa-miR-504	AGACCCUGGUCUGCACUCUAU
miR-7	256	263	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CHD3