Gene Page: FBXO32
Summary ?
| GeneID | 114907 |
| Symbol | FBXO32 |
| Synonyms | Fbx32|MAFbx |
| Description | F-box protein 32 |
| Reference | MIM:606604|HGNC:HGNC:16731|Ensembl:ENSG00000156804|HPRD:05966|Vega:OTTHUMG00000164981 |
| Gene type | protein-coding |
| Map location | 8q24.13 |
| Pascal p-value | 0.488 |
| Sherlock p-value | 0.911 |
| DEG p-value | DEG:Sanders_2014:DS1_p=-0.133:DS1_beta=0.038700:DS2_p=5.47e-01:DS2_beta=0.028:DS2_FDR=7.61e-01 |
| Fetal beta | -1.02 |
| DMG | 1 (# studies) |
| eGene | Putamen basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
| Expression | Meta-analysis of gene expression | P value: 1.411 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg20283107 | 8 | 124788969 | FBXO32 | 2.75E-6 | 7.448 | DMG:vanEijk_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2922180 | chr3 | 125280472 | FBXO32 | 114907 | 0.04 | trans | ||
| rs16894149 | chr5 | 61013724 | FBXO32 | 114907 | 0.02 | trans | ||
| rs11954814 | chr5 | 155088338 | FBXO32 | 114907 | 0.04 | trans | ||
| rs283058 | chr6 | 118625224 | FBXO32 | 114907 | 0.13 | trans | ||
| rs3823550 | chr7 | 137346101 | FBXO32 | 114907 | 0.09 | trans | ||
| rs4149623 | chr12 | 6450577 | FBXO32 | 114907 | 0.02 | trans | ||
| rs9529974 | chr13 | 72821935 | FBXO32 | 114907 | 0.16 | trans | ||
| rs1951867 | chr14 | 54407191 | FBXO32 | 114907 | 0.05 | trans | ||
| rs17244419 | chr14 | 97171074 | FBXO32 | 114907 | 0.17 | trans | ||
| rs9627183 | chr22 | 48284513 | FBXO32 | 114907 | 0.1 | trans | ||
| rs9627184 | chr22 | 48284887 | FBXO32 | 114907 | 0.15 | trans | ||
| rs6988439 | 8 | 124522753 | FBXO32 | ENSG00000156804.3 | 1.446E-6 | 0 | 30693 | gtex_brain_putamen_basal |
| rs2294088 | 8 | 124526607 | FBXO32 | ENSG00000156804.3 | 6.719E-8 | 0 | 26839 | gtex_brain_putamen_basal |
| rs10111521 | 8 | 124528196 | FBXO32 | ENSG00000156804.3 | 4.287E-8 | 0 | 25250 | gtex_brain_putamen_basal |
| rs7834818 | 8 | 124529377 | FBXO32 | ENSG00000156804.3 | 8.336E-8 | 0 | 24069 | gtex_brain_putamen_basal |
| rs2385291 | 8 | 124536822 | FBXO32 | ENSG00000156804.3 | 3.483E-8 | 0 | 16624 | gtex_brain_putamen_basal |
| rs7818812 | 8 | 124538590 | FBXO32 | ENSG00000156804.3 | 1.312E-6 | 0 | 14856 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID FOXO PATHWAY | 49 | 43 | All SZGR 2.0 genes in this pathway |
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
| BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA FRA2 TARGETS | 43 | 27 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 8Q23 Q24 AMPLICON | 157 | 87 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
| KUNINGER IGF1 VS PDGFB TARGETS DN | 46 | 28 | All SZGR 2.0 genes in this pathway |
| LINDVALL IMMORTALIZED BY TERT DN | 80 | 56 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| HOWLIN CITED1 TARGETS 2 UP | 17 | 10 | All SZGR 2.0 genes in this pathway |
| SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
| IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| STAMBOLSKY RESPONSE TO VITAMIN D3 DN | 26 | 14 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA VIA KDM3A | 53 | 34 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 221 | 227 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-144 | 220 | 227 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.