Gene Page: CKB
Summary ?
GeneID | 1152 |
Symbol | CKB |
Synonyms | B-CK|BCK|CKBB|HEL-211|HEL-S-29 |
Description | creatine kinase, brain |
Reference | MIM:123280|HGNC:HGNC:1991|Ensembl:ENSG00000166165|HPRD:00423|Vega:OTTHUMG00000171786 |
Gene type | protein-coding |
Map location | 14q32 |
Pascal p-value | 2.753E-9 |
Sherlock p-value | 0.069 |
Fetal beta | -1.049 |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MYNN | 0.94 | 0.93 |
KLHL7 | 0.93 | 0.91 |
COPB1 | 0.93 | 0.93 |
ZNF484 | 0.92 | 0.89 |
DCAF13 | 0.92 | 0.89 |
SNX4 | 0.92 | 0.89 |
HSF2 | 0.92 | 0.91 |
ZNF569 | 0.91 | 0.90 |
GNAI3 | 0.91 | 0.83 |
MCPH1 | 0.91 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.68 | -0.83 |
HLA-F | -0.68 | -0.79 |
MT-CO2 | -0.68 | -0.84 |
AF347015.33 | -0.67 | -0.83 |
MT-CYB | -0.67 | -0.84 |
AF347015.8 | -0.67 | -0.85 |
AF347015.31 | -0.66 | -0.82 |
AF347015.15 | -0.66 | -0.85 |
AIFM3 | -0.64 | -0.75 |
TINAGL1 | -0.64 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004111 | creatine kinase activity | TAS | 3034271 | |
GO:0005524 | ATP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006600 | creatine metabolic process | EXP | 10893433 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 16981706 | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005739 | mitochondrion | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ARGININE AND PROLINE METABOLISM | 54 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA DN | 349 | 157 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP | 158 | 103 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
DUNNE TARGETS OF AML1 MTG8 FUSION DN | 19 | 17 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA UP | 73 | 47 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN | 98 | 59 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
GOUYER TUMOR INVASIVENESS | 9 | 5 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION UP | 142 | 93 | All SZGR 2.0 genes in this pathway |
NADLER OBESITY UP | 61 | 34 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX UP | 83 | 66 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
APRELIKOVA BRCA1 TARGETS | 49 | 33 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS DN | 29 | 16 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS UP | 88 | 47 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C DN | 59 | 39 | All SZGR 2.0 genes in this pathway |
CHAUHAN RESPONSE TO METHOXYESTRADIOL UP | 51 | 32 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS INTERFERON DN | 52 | 30 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
VANDESLUIS COMMD1 TARGETS GROUP 4 DN | 16 | 11 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR TARGETS DN | 24 | 16 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-139 | 107 | 113 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-324-3p | 52 | 58 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.