Gene Page: UNC45B
Summary ?
| GeneID | 146862 |
| Symbol | UNC45B |
| Synonyms | CMYA4|CTRCT43|SMUNC45|UNC-45B|UNC45 |
| Description | unc-45 myosin chaperone B |
| Reference | MIM:611220|HGNC:HGNC:14304|Ensembl:ENSG00000141161|HPRD:10840|Vega:OTTHUMG00000132931 |
| Gene type | protein-coding |
| Map location | 17q12 |
| Pascal p-value | 0.617 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005488 | binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
| DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
| MCMURRAY TP53 HRAS COOPERATION RESPONSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
| PHESSE TARGETS OF APC AND MBD2 UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-324-5p | 14 | 20 | m8 | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
| miR-329 | 373 | 379 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-338 | 17 | 23 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.