Gene Page: TXLNB
Summary ?
| GeneID | 167838 |
| Symbol | TXLNB |
| Synonyms | C6orf198|LST001|MDP77|dJ522B19.2 |
| Description | taxilin beta |
| Reference | MIM:611438|HGNC:HGNC:21617|Ensembl:ENSG00000164440|HPRD:10793|Vega:OTTHUMG00000015688 |
| Gene type | protein-coding |
| Map location | 6q24.1 |
| Pascal p-value | 0.019 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005737 | cytoplasm | IDA | 11256614 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-369-3p | 1858 | 1864 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 1858 | 1865 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-409-3p | 1916 | 1923 | 1A,m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
| miR-543 | 2247 | 2253 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.