Gene Page: EPHB3
Summary ?
GeneID | 2049 |
Symbol | EPHB3 |
Synonyms | ETK2|HEK2|TYRO6 |
Description | EPH receptor B3 |
Reference | MIM:601839|HGNC:HGNC:3394|Ensembl:ENSG00000182580|HPRD:03502|Vega:OTTHUMG00000156710 |
Gene type | protein-coding |
Map location | 3q27.1 |
Pascal p-value | 0.568 |
Fetal beta | -0.63 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
EPHB3 | chr3 | 184295448 | C | T | NM_004443 NM_004443 | . . | silent splice | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/EPHB3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AL161668.2 | 0.91 | 0.91 |
MRC2 | 0.90 | 0.79 |
SMO | 0.90 | 0.87 |
EPHB4 | 0.88 | 0.81 |
MMP14 | 0.88 | 0.83 |
CHST14 | 0.87 | 0.84 |
PALLD | 0.87 | 0.81 |
PRKD2 | 0.87 | 0.75 |
PTBP1 | 0.86 | 0.85 |
DDR1 | 0.86 | 0.82 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.41 | -0.43 |
CA4 | -0.39 | -0.39 |
EPHX4 | -0.38 | -0.40 |
SERPINI1 | -0.38 | -0.39 |
CHN1 | -0.37 | -0.35 |
RERGL | -0.37 | -0.46 |
KMO | -0.37 | -0.43 |
ABCC12 | -0.36 | -0.42 |
AF347015.21 | -0.36 | -0.46 |
AF347015.31 | -0.36 | -0.40 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008046 | axon guidance receptor activity | IEA | axon (GO term level: 6) | - |
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005003 | ephrin receptor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 8397371 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 8397371 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
AIYAR COBRA1 TARGETS DN | 29 | 18 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS DN | 66 | 39 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL RUNX1 | 9 | 6 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS UP | 126 | 84 | All SZGR 2.0 genes in this pathway |
HOEGERKORP CD44 TARGETS DIRECT DN | 14 | 7 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C1 | 19 | 15 | All SZGR 2.0 genes in this pathway |
DELLA RESPONSE TO TSA AND BUTYRATE | 21 | 17 | All SZGR 2.0 genes in this pathway |
VERRECCHIA EARLY RESPONSE TO TGFB1 | 58 | 43 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE MIDDLE | 98 | 56 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
GHANDHI BYSTANDER IRRADIATION DN | 12 | 10 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-149 | 610 | 617 | 1A,m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-19 | 485 | 492 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-29 | 538 | 544 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-326 | 592 | 599 | 1A,m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-339 | 490 | 496 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.