Gene Page: MECOM
Summary ?
GeneID | 2122 |
Symbol | MECOM |
Synonyms | AML1-EVI-1|EVI1|MDS1|MDS1-EVI1|PRDM3|RUSAT2 |
Description | MDS1 and EVI1 complex locus |
Reference | MIM:165215|HGNC:HGNC:3498|Ensembl:ENSG00000085276|HPRD:01310|Vega:OTTHUMG00000158596 |
Gene type | protein-coding |
Map location | 3q26.2 |
Pascal p-value | 0.021 |
Sherlock p-value | 0.004 |
Fetal beta | -0.034 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14572252 | 3 | 169309425 | MECOM | 2.47E-5 | -0.481 | 0.017 | DMG:Wockner_2014 |
cg20201475 | 3 | 168867307 | MECOM | 5.9E-5 | -0.2 | 0.023 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9831599 | chr3 | 66353151 | MECOM | 2122 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SMCR7L | 0.92 | 0.95 |
USP22 | 0.90 | 0.94 |
ZFYVE1 | 0.90 | 0.93 |
CEP68 | 0.90 | 0.94 |
ATP9A | 0.89 | 0.94 |
URB1 | 0.89 | 0.93 |
FAM123C | 0.89 | 0.92 |
TGFBRAP1 | 0.89 | 0.93 |
MTMR4 | 0.89 | 0.93 |
CAMSAP1 | 0.89 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.71 | -0.80 |
FXYD1 | -0.70 | -0.79 |
MT-CO2 | -0.70 | -0.80 |
HIGD1B | -0.68 | -0.79 |
AF347015.33 | -0.68 | -0.75 |
AF347015.21 | -0.67 | -0.84 |
AC021016.1 | -0.67 | -0.76 |
AF347015.8 | -0.67 | -0.79 |
MT-CYB | -0.67 | -0.76 |
AF347015.27 | -0.66 | -0.77 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
GO:0003677 | DNA binding | IEA | - | |
GO:0005515 | protein binding | IPI | 11328817 |17635584 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0001701 | in utero embryonic development | IEA | - | |
GO:0001780 | neutrophil homeostasis | IEA | - | |
GO:0009605 | response to external stimulus | IEA | - | |
GO:0009617 | response to bacterium | IEA | - | |
GO:0009791 | post-embryonic development | IEA | - | |
GO:0008150 | biological_process | ND | - | |
GO:0006954 | inflammatory response | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0042127 | regulation of cell proliferation | IEA | - | |
GO:0035115 | embryonic forelimb morphogenesis | IEA | - | |
GO:0035116 | embryonic hindlimb morphogenesis | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0060039 | pericardium development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
FRASOR TAMOXIFEN RESPONSE UP | 51 | 36 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES DN | 145 | 91 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE DN | 61 | 35 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN | 74 | 44 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP UP | 265 | 158 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP | 137 | 84 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
MISSIAGLIA REGULATED BY METHYLATION DN | 122 | 67 | All SZGR 2.0 genes in this pathway |
WANG ESOPHAGUS CANCER VS NORMAL UP | 121 | 72 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 7 | 8 | 6 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP | 109 | 69 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
TENEDINI MEGAKARYOCYTE MARKERS | 66 | 48 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
PARK HSC MARKERS | 44 | 31 | All SZGR 2.0 genes in this pathway |
NUMATA CSF3 SIGNALING VIA STAT3 | 22 | 17 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
SU PANCREAS | 54 | 30 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
GEORGANTAS HSC MARKERS | 71 | 47 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE UP | 126 | 92 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE UP | 70 | 49 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 1 | 28 | 19 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
PYEON CANCER HEAD AND NECK VS CERVICAL UP | 193 | 95 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP C | 92 | 60 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 88 | 94 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 88 | 94 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-133 | 23 | 30 | 1A,m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-214 | 75 | 81 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-378* | 29 | 36 | 1A,m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
miR-504 | 103 | 110 | 1A,m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.