SZGR2

Summary ?

GeneID	2137
Symbol	EXTL3
Synonyms	BOTV\|EXTL1L\|EXTR1\|REGR\|RPR
Description	exostosin like glycosyltransferase 3
Reference	MIM:605744\|HGNC:HGNC:3518\|Ensembl:ENSG00000012232\|HPRD:09306\|Vega:OTTHUMG00000102146
Gene type	protein-coding
Map location	8p21
Pascal p-value	0.574
Sherlock p-value	0.988
Fetal beta	-0.007
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.03086
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.00057

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06012410	8	28567012	EXTL3	4.876E-4	0.51	0.047	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17795337	chr6	136492658	EXTL3	2137		0.09		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ATP13A4	0.90	0.90
MERTK	0.89	0.84
SLC13A5	0.88	0.85
ATP1B2	0.88	0.84
ACSBG1	0.88	0.84
ATP1A2	0.88	0.85
FAM167A	0.87	0.80
ADHFE1	0.87	0.83
SFXN5	0.86	0.82
ACSS1	0.86	0.82

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MED19	-0.56	-0.60
RAB33A	-0.55	-0.63
MLLT11	-0.54	-0.57
C6orf168	-0.53	-0.54
SPATS2	-0.53	-0.56
DCTPP1	-0.53	-0.61
CIAPIN1	-0.53	-0.56
PREP	-0.53	-0.54
MTHFD1L	-0.52	-0.57
MAD2L1BP	-0.52	-0.59

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001888	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity	IEA		-
GO:0016757	transferase activity, transferring glycosyl groups	IEA		-
GO:0030145	manganese ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005783	endoplasmic reticulum	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG GLYCOSAMINOGLYCAN BIOSYNTHESIS HEPARAN SULFATE	26	16	All SZGR 2.0 genes in this pathway
REACTOME DIABETES PATHWAYS	133	91	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF CHAPERONE GENES BY XBP1S	46	34	All SZGR 2.0 genes in this pathway
REACTOME UNFOLDED PROTEIN RESPONSE	80	51	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN	129	84	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN	196	131	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5	126	78	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO NIMUSTINE	17	13	All SZGR 2.0 genes in this pathway
NIELSEN GIST	98	66	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	1541	1548	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1541	1547	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1541	1547	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-136	2803	2810	1A,m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-218	2759	2765	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-9	1935	1941	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EXTL3