Gene Page: EPB41L3
Summary ?
GeneID | 23136 |
Symbol | EPB41L3 |
Synonyms | 4.1B|DAL-1|DAL1 |
Description | erythrocyte membrane protein band 4.1-like 3 |
Reference | MIM:605331|HGNC:HGNC:3380|Ensembl:ENSG00000082397|HPRD:05622|Vega:OTTHUMG00000131562 |
Gene type | protein-coding |
Map location | 18p11.32 |
Pascal p-value | 0.138 |
Sherlock p-value | 0.944 |
Fetal beta | -1.693 |
DMG | 1 (# studies) |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06459104 | 18 | 5456880 | EPB41L3 | 4.183E-4 | -0.688 | 0.044 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FLCN | 0.90 | 0.90 |
DPP9 | 0.89 | 0.89 |
ZNF335 | 0.89 | 0.90 |
FAM160B2 | 0.89 | 0.91 |
FLII | 0.89 | 0.90 |
POLG | 0.89 | 0.89 |
ATP8B2 | 0.89 | 0.92 |
PLEKHM1 | 0.88 | 0.89 |
SYVN1 | 0.88 | 0.88 |
HMGXB3 | 0.87 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.73 | -0.74 |
AF347015.31 | -0.67 | -0.65 |
GNG11 | -0.65 | -0.66 |
C1orf54 | -0.63 | -0.68 |
MT-CO2 | -0.63 | -0.62 |
AF347015.27 | -0.63 | -0.63 |
AF347015.8 | -0.62 | -0.61 |
AL050337.1 | -0.59 | -0.61 |
MT-CYB | -0.59 | -0.57 |
MT-ATP8 | -0.58 | -0.65 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005488 | binding | IEA | - | |
GO:0005198 | structural molecule activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008150 | biological_process | ND | - | |
GO:0030866 | cortical actin cytoskeleton organization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005911 | cell-cell junction | IDA | 12234973 | |
GO:0005886 | plasma membrane | NAS | 9892180 | |
GO:0019898 | extrinsic to membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CADM1 | BL2 | DKFZp686F1789 | IGSF4 | IGSF4A | MGC149785 | MGC51880 | NECL2 | Necl-2 | RA175 | ST17 | SYNCAM | TSLC1 | sTSLC-1 | sgIGSF | synCAM1 | cell adhesion molecule 1 | - | HPRD,BioGRID | 12234973 |
CD44 | CDW44 | CSPG8 | ECMR-III | HCELL | IN | LHR | MC56 | MDU2 | MDU3 | MGC10468 | MIC4 | MUTCH-I | Pgp1 | CD44 molecule (Indian blood group) | EPB41L3 (DAL-1) interacts with an unspecified isoform of CD44. | BIND | 15688033 |
CEP152 | KIAA0912 | centrosomal protein 152kDa | - | HPRD | 12421765 |
CNTNAP2 | AUTS15 | CASPR2 | CDFE | DKFZp781D1846 | NRXN4 | contactin associated protein-like 2 | - | HPRD,BioGRID | 12542678 |
MBIP | - | MAP3K12 binding inhibitory protein 1 | Two-hybrid | BioGRID | 16189514 |
PLA2G2A | MOM1 | PLA2 | PLA2B | PLA2L | PLA2S | PLAS1 | sPLA2 | phospholipase A2, group IIA (platelets, synovial fluid) | EPB41L3 (DAL-1) interacts with an unspecified isoform of PLA2G2A (14-3-3). | BIND | 15688033 |
SMYD2 | HSKM-B | KMT3C | MGC119305 | ZMYND14 | SET and MYND domain containing 2 | Affinity Capture-MS | BioGRID | 17353931 |
SPTBN1 | ELF | SPTB2 | betaSpII | spectrin, beta, non-erythrocytic 1 | Reconstituted Complex | BioGRID | 15116094 |
SPTBN1 | ELF | SPTB2 | betaSpII | spectrin, beta, non-erythrocytic 1 | EPB41L3 (DAL-1) interacts with an unspecified isoform of SPTBN1 (beta-II-spectrin). | BIND | 15688033 |
YWHAB | GW128 | HS1 | KCIP-1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | - | HPRD,BioGRID | 11996670 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD,BioGRID | 11996670 |
YWHAH | YWHA1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide | - | HPRD,BioGRID | 11996670 |
YWHAQ | 14-3-3 | 1C5 | HS1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL UP | 44 | 25 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL UP | 73 | 50 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST CARCINOMA DUCTAL VS LOBULAR UP | 21 | 14 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA UP | 33 | 28 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER CLUSTER 2 | 42 | 31 | All SZGR 2.0 genes in this pathway |
DACOSTA ERCC3 ALLELE XPCS VS TTD UP | 28 | 19 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
WOOD EBV EBNA1 TARGETS DN | 47 | 33 | All SZGR 2.0 genes in this pathway |
MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL UP | 37 | 28 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
MCDOWELL ACUTE LUNG INJURY DN | 48 | 33 | All SZGR 2.0 genes in this pathway |
TRACEY RESISTANCE TO IFNA2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
GRADE COLON VS RECTAL CANCER DN | 56 | 36 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 5 | 33 | 24 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 938 | 944 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-223 | 89 | 95 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-26 | 874 | 881 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-96 | 493 | 499 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.