Gene Page: GPD1L
Summary ?
GeneID | 23171 |
Symbol | GPD1L |
Synonyms | GPD1-L |
Description | glycerol-3-phosphate dehydrogenase 1-like |
Reference | MIM:611778|HGNC:HGNC:28956|Ensembl:ENSG00000152642|HPRD:10008|Vega:OTTHUMG00000155846 |
Gene type | protein-coding |
Map location | 3p22.3 |
Pascal p-value | 0.04 |
Sherlock p-value | 0.242 |
eGene | Frontal Cortex BA9 Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1561519 | chr2 | 35823020 | GPD1L | 23171 | 0.1 | trans | ||
rs7591339 | chr2 | 35825597 | GPD1L | 23171 | 0.1 | trans | ||
rs7570146 | chr2 | 35844751 | GPD1L | 23171 | 0.1 | trans | ||
rs1439691 | chr2 | 35851281 | GPD1L | 23171 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DGKZ | 0.94 | 0.90 |
ICAM5 | 0.92 | 0.90 |
KCNN1 | 0.91 | 0.89 |
ARHGEF4 | 0.90 | 0.84 |
CHRD | 0.90 | 0.88 |
EXTL1 | 0.89 | 0.89 |
FAM131A | 0.89 | 0.86 |
SLC17A7 | 0.88 | 0.85 |
CHRM1 | 0.88 | 0.82 |
FMNL1 | 0.88 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KIAA1949 | -0.55 | -0.42 |
RBMX2 | -0.55 | -0.61 |
TUBB2B | -0.54 | -0.49 |
LEMD1 | -0.54 | -0.50 |
FNBP1L | -0.52 | -0.34 |
ZNF300 | -0.52 | -0.35 |
IDH1 | -0.52 | -0.42 |
ZNF193 | -0.52 | -0.42 |
TIGD1 | -0.52 | -0.41 |
HEBP2 | -0.52 | -0.64 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | IEA | - | |
GO:0004367 | glycerol-3-phosphate dehydrogenase (NAD+) activity | IEA | - | |
GO:0051287 | NAD binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005975 | carbohydrate metabolic process | IEA | - | |
GO:0046168 | glycerol-3-phosphate catabolic process | IEA | - | |
GO:0055114 | oxidation reduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0009331 | glycerol-3-phosphate dehydrogenase complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLYCEROPHOSPHOLIPID METABOLISM | 77 | 35 | All SZGR 2.0 genes in this pathway |
REACTOME TRIGLYCERIDE BIOSYNTHESIS | 38 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF PA | 27 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME GLYCEROPHOSPHOLIPID BIOSYNTHESIS | 82 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
DOANE BREAST CANCER CLASSES UP | 72 | 38 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP | 109 | 69 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
STARK HYPPOCAMPUS 22Q11 DELETION UP | 53 | 40 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
SCHUHMACHER MYC TARGETS UP | 80 | 57 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
HUANG DASATINIB RESISTANCE DN | 69 | 44 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER CLUSTER 6 | 16 | 13 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-139 | 2743 | 2749 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-181 | 2480 | 2487 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-210 | 1632 | 1638 | m8 | hsa-miR-210 | CUGUGCGUGUGACAGCGGCUGA |
miR-27 | 2477 | 2483 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.