Gene Page: SEL1L3
Summary ?
GeneID | 23231 |
Symbol | SEL1L3 |
Synonyms | Sel-1L3 |
Description | SEL1L family member 3 |
Reference | HGNC:HGNC:29108|Ensembl:ENSG00000091490|HPRD:11105|Vega:OTTHUMG00000160331 |
Gene type | protein-coding |
Map location | 4p15.2 |
Pascal p-value | 0.021 |
Sherlock p-value | 0.171 |
Fetal beta | 0.144 |
eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 1 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs959903 | 4 | 25810096 | null | 1.541 | SEL1L3 | null |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
snp_a-4290143 | 0 | SEL1L3 | 23231 | 0.07 | trans | |||
rs16829545 | chr2 | 151977407 | SEL1L3 | 23231 | 1.48E-13 | trans | ||
rs3747518 | chr2 | 163128724 | SEL1L3 | 23231 | 0.15 | trans | ||
rs3845734 | chr2 | 171125572 | SEL1L3 | 23231 | 0 | trans | ||
rs7584986 | chr2 | 184111432 | SEL1L3 | 23231 | 1.101E-7 | trans | ||
rs16889812 | chr4 | 14195043 | SEL1L3 | 23231 | 0.19 | trans | ||
rs16889813 | chr4 | 14196540 | SEL1L3 | 23231 | 0.05 | trans | ||
rs2183142 | chr4 | 159232695 | SEL1L3 | 23231 | 0 | trans | ||
rs337984 | chr4 | 173411662 | SEL1L3 | 23231 | 0.15 | trans | ||
rs3111196 | chr5 | 54402889 | SEL1L3 | 23231 | 0.02 | trans | ||
rs1380396 | chr5 | 100737044 | SEL1L3 | 23231 | 0.08 | trans | ||
rs6887062 | chr5 | 123850762 | SEL1L3 | 23231 | 0.03 | trans | ||
rs327867 | chr5 | 125217366 | SEL1L3 | 23231 | 0.14 | trans | ||
rs9461864 | chr6 | 33481468 | SEL1L3 | 23231 | 0 | trans | ||
rs16890367 | chr6 | 38078448 | SEL1L3 | 23231 | 0.1 | trans | ||
rs7794215 | chr7 | 11477363 | SEL1L3 | 23231 | 0.18 | trans | ||
rs3118341 | chr9 | 25185518 | SEL1L3 | 23231 | 0.03 | trans | ||
rs2225105 | chr9 | 25480908 | SEL1L3 | 23231 | 0.15 | trans | ||
rs16955618 | chr15 | 29937543 | SEL1L3 | 23231 | 7.665E-18 | trans | ||
rs17540498 | chr15 | 93800424 | SEL1L3 | 23231 | 0.12 | trans | ||
rs11882889 | chr19 | 19887684 | SEL1L3 | 23231 | 0.01 | trans | ||
rs1041786 | chr21 | 22617710 | SEL1L3 | 23231 | 0 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RERE | 0.94 | 0.96 |
BAT2 | 0.94 | 0.95 |
PRR12 | 0.92 | 0.95 |
SETD1A | 0.92 | 0.94 |
ATXN2L | 0.92 | 0.94 |
SMARCC2 | 0.92 | 0.93 |
SRCAP | 0.92 | 0.95 |
ZC3H18 | 0.91 | 0.92 |
SF3A1 | 0.91 | 0.91 |
KHSRP | 0.91 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.76 | -0.83 |
HIGD1B | -0.74 | -0.83 |
MT-CO2 | -0.73 | -0.82 |
FXYD1 | -0.73 | -0.79 |
S100B | -0.72 | -0.79 |
IFI27 | -0.70 | -0.77 |
PSMB9 | -0.70 | -0.76 |
B2M | -0.70 | -0.75 |
COPZ2 | -0.70 | -0.75 |
AF347015.33 | -0.70 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
ROY WOUND BLOOD VESSEL UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY UP | 78 | 41 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE UP | 52 | 36 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 2HR UP | 27 | 19 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 6HR UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
KLEIN PRIMARY EFFUSION LYMPHOMA DN | 58 | 42 | All SZGR 2.0 genes in this pathway |
LU IL4 SIGNALING | 94 | 56 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
TRAYNOR RETT SYNDROM DN | 19 | 14 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
MCLACHLAN DENTAL CARIES UP | 253 | 147 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 15 | 31 | 19 | All SZGR 2.0 genes in this pathway |
VALK AML WITH CEBPA | 37 | 27 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G5 DN | 27 | 17 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN | 170 | 105 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
NOUSHMEHR GBM SILENCED BY METHYLATION | 50 | 32 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 UP | 140 | 94 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-145 | 107 | 113 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-185 | 16 | 23 | 1A,m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-30-5p | 568 | 574 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.