Gene Page: GIGYF2
Summary ?
GeneID | 26058 |
Symbol | GIGYF2 |
Synonyms | GYF2|PARK11|PERQ2|PERQ3|TNRC15 |
Description | GRB10 interacting GYF protein 2 |
Reference | MIM:612003|HGNC:HGNC:11960|Ensembl:ENSG00000204120|HPRD:11639| |
Gene type | protein-coding |
Map location | 2q37.1 |
Pascal p-value | 5.268E-9 |
Sherlock p-value | 0.556 |
Fetal beta | 0.512 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
LK:YES | Genome-wide Association Study | This data set included 99 genes mapped to the 22 regions. The 24 leading SNPs were also included in CV:Ripke_2013 | |
Expression | Meta-analysis of gene expression | P value: 1.654 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs6704768 | chr2 | 233592501 | AG | 3.148E-12 | intronic | GIGYF2 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/GIGYF2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 16120600 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN | 143 | 83 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
TERAMOTO OPN TARGETS CLUSTER 5 | 7 | 5 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-143 | 185 | 191 | 1A | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA | ||||
miR-188 | 933 | 939 | 1A | hsa-miR-188 | CAUCCCUUGCAUGGUGGAGGGU |
hsa-miR-188 | CAUCCCUUGCAUGGUGGAGGGU | ||||
miR-30-3p | 1063 | 1069 | 1A | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-30-5p | 1681 | 1688 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-330 | 1633 | 1639 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-485-3p | 902 | 909 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.