Gene Page: GFRA2
Summary ?
| GeneID | 2675 |
| Symbol | GFRA2 |
| Synonyms | GDNFRB|NRTNR-ALPHA|NTNRA|RETL2|TRNR2 |
| Description | GDNF family receptor alpha 2 |
| Reference | MIM:601956|HGNC:HGNC:4244|HPRD:11801| |
| Gene type | protein-coding |
| Map location | 8p21.3 |
| Pascal p-value | 0.057 |
| Sherlock p-value | 0.097 |
| Fetal beta | -1.56 |
| eGene | Anterior cingulate cortex BA24 Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7838399 | chr8 | 8457079 | GFRA2 | 2675 | 0.09 | trans | ||
| rs10216972 | 8 | 22613802 | GFRA2 | ENSG00000168546.6 | 1.59889E-6 | 0.05 | -943933 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016167 | glial cell line-derived neurotrophic factor receptor activity | TAS | neurotrophic, Glial (GO term level: 7) | 10829012 |
| GO:0004872 | receptor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | TAS | 9192898 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0031225 | anchored to membrane | IEA | - | |
| GO:0019898 | extrinsic to membrane | TAS | 10829012 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
| CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| ASTIER INTEGRIN SIGNALING | 59 | 44 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| MAHAJAN RESPONSE TO IL1A UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
| HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 95 | 102 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-299-5p | 170 | 177 | 1A,m8 | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-369-3p | 1097 | 1103 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-384 | 1250 | 1256 | m8 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| miR-450 | 95 | 101 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.