SZGR2

Summary ?

GeneID	2737
Symbol	GLI3
Synonyms	ACLS\|GCPS\|GLI3-190\|GLI3FL\|PAP-A\|PAPA\|PAPA1\|PAPB\|PHS\|PPDIV
Description	GLI family zinc finger 3
Reference	MIM:165240\|HGNC:HGNC:4319\|Ensembl:ENSG00000106571\|HPRD:01313\|Vega:OTTHUMG00000023630
Gene type	protein-coding
Map location	7p13
Pascal p-value	0.053
Sherlock p-value	0.414
TADA p-value	0.028
Fetal beta	3.141
eGene	Myers' cis & trans
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
GLI3	chr7	42079692	G	A	NM_000168	p.325R>C	missense			Schizophrenia	DNM:Fromer_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs846300	chr7	42055260	GLI3	2737	0.06	cis
rs17301762	chr1	180794652	GLI3	2737	0.07	trans
rs17302102	chr1	180866344	GLI3	2737	0.07	trans
rs17801458	chr2	142468471	GLI3	2737	0.02	trans
rs16870771	chr4	21307780	GLI3	2737	0.05	trans
rs6879593	chr5	75253310	GLI3	2737	0.03	trans
rs17061935	chr6	101873751	GLI3	2737	0.06	trans
rs2225177	chr10	108777243	GLI3	2737	0.14	trans
rs1111195	chr16	51416325	GLI3	2737	0.15	trans
rs9944345	chr16	51419164	GLI3	2737	0.15	trans
rs16981461	chr20	56490699	GLI3	2737	0.13	trans
rs3099706		0	GLI3	2737	0.16	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003682	chromatin binding	IEA		-
GO:0003700	transcription factor activity	TAS		9054938 \|10077605
GO:0005515	protein binding	IPI		10564661 \|10806483 \|11238441
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0048663	neuron fate commitment	IEA	neuron (GO term level: 9)	-
GO:0021631	optic nerve morphogenesis	IEA	Brain (GO term level: 9)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0021915	neural tube development	IEA	Brain (GO term level: 7)	-
GO:0021776	smoothened signaling pathway involved in spinal cord motor neuron cell fate specification	IEA	neuron (GO term level: 12)	-
GO:0021775	smoothened signaling pathway involved in ventral spinal cord interneuron specification	IEA	neuron (GO term level: 12)	-
GO:0000060	protein import into nucleus, translocation	TAS		10077605
GO:0001658	ureteric bud branching	IEA		-
GO:0001656	metanephros development	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0009954	proximal/distal pattern formation	IEA		-
GO:0007224	smoothened signaling pathway	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0007165	signal transduction	TAS		10077605
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0007507	heart development	IEA		-
GO:0007442	hindgut morphogenesis	IEA		-
GO:0007389	pattern specification process	IEA		-
GO:0016481	negative regulation of transcription	IEA		-
GO:0042475	odontogenesis of dentine-containing tooth	IEA		-
GO:0030879	mammary gland development	IEA		-
GO:0030326	embryonic limb morphogenesis	IEA		-
GO:0030324	lung development	IEA		-
GO:0035295	tube development	IEA		-
GO:0021513	spinal cord dorsal/ventral patterning	IEA		-
GO:0045596	negative regulation of cell differentiation	IEA		-
GO:0048558	embryonic gut morphogenesis	IEA		-
GO:0048589	developmental growth	IEA		-
GO:0048593	camera-type eye morphogenesis	IEA		-
GO:0048598	embryonic morphogenesis	IEA		-
GO:0048646	anatomical structure formation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	TAS		10077605
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	TAS		10077605
GO:0017053	transcriptional repressor complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Affinity Capture-Western Reconstituted Complex	BioGRID	10075717
SMAD1	BSP1 \| JV4-1 \| JV41 \| MADH1 \| MADR1	SMAD family member 1	-	HPRD	9843199
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD	9843199
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD	9843199
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD	9843199
STK36	DKFZp434N0223 \| FU \| KIAA1278	serine/threonine kinase 36, fused homolog (Drosophila)	-	HPRD,BioGRID	10806483
SUFU	PRO1280 \| SUFUH \| SUFUXL	suppressor of fused homolog (Drosophila)	-	HPRD,BioGRID	10564661
TWIST1	ACS3 \| BPES2 \| BPES3 \| SCS \| TWIST \| bHLHa38	twist homolog 1 (Drosophila)	-	HPRD	12142027
ZIC1	ZIC \| ZNF201	Zic family member 1 (odd-paired homolog, Drosophila)	-	HPRD,BioGRID	11238441
ZIC2	HPE5	Zic family member 2 (odd-paired homolog, Drosophila)	Affinity Capture-Western Reconstituted Complex	BioGRID	11238441
ZIC3	HTX \| HTX1 \| ZNF203	Zic family member 3 (odd-paired homolog, Drosophila)	Reconstituted Complex	BioGRID	11238441

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
BIOCARTA SHH PATHWAY	16	15	All SZGR 2.0 genes in this pathway
PID HEDGEHOG GLI PATHWAY	48	35	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP DN	35	20	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX DN	80	49	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE DN	87	59	All SZGR 2.0 genes in this pathway
MARIADASON REGULATED BY HISTONE ACETYLATION UP	83	49	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR DN	101	64	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
NAKAMURA METASTASIS MODEL DN	43	28	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 DN	44	28	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR	27	12	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	2859	2865	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	2858	2865	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	2858	2865	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-143	107	114	1A,m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-200bc/429	217	223	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-203.1	201	207	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-24	2826	2832	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-494	3333	3339	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-496	3149	3156	1A,m8	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-7	195	202	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GLI3