Gene Page: GNL1
Summary ?
| GeneID | 2794 |
| Symbol | GNL1 |
| Synonyms | HSR1 |
| Description | G protein nucleolar 1 (putative) |
| Reference | MIM:143024|HGNC:HGNC:4413|Ensembl:ENSG00000204590|HPRD:00879|Vega:OTTHUMG00000031137 |
| Gene type | protein-coding |
| Map location | 6p21.3 |
| Pascal p-value | 2.098E-14 |
| Fetal beta | -0.09 |
| DMG | 1 (# studies) |
| eGene | Meta |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg23654545 | 6 | 30525120 | PRR3;GNL1 | 3.853E-4 | -0.207 | 0.043 | DMG:Wockner_2014 |
| cg14284643 | 6 | 30524853 | GNL1 | 1.83E-9 | -0.02 | 1.57E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC087749.2 | 0.70 | 0.71 |
| MYO15B | 0.64 | 0.71 |
| C9orf131 | 0.62 | 0.65 |
| AC103810.3 | 0.62 | 0.66 |
| C10orf108 | 0.60 | 0.53 |
| SLC34A3 | 0.60 | 0.58 |
| MALAT1 | 0.59 | 0.61 |
| ARHGEF1 | 0.59 | 0.67 |
| AP000769.2 | 0.59 | 0.61 |
| ZBTB32 | 0.58 | 0.53 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TMEM70 | -0.49 | -0.51 |
| CAPZA2 | -0.48 | -0.50 |
| C18orf32 | -0.47 | -0.58 |
| BRP44 | -0.47 | -0.51 |
| COMMD10 | -0.47 | -0.52 |
| UQCRFSL1 | -0.46 | -0.49 |
| TMEM126A | -0.46 | -0.53 |
| MRPL15 | -0.45 | -0.47 |
| COX5A | -0.44 | -0.49 |
| NDUFAB1 | -0.44 | -0.45 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0005525 | GTP binding | NAS | 8180467 | |
| GO:0005198 | structural molecule activity | NAS | 8180467 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0002456 | T cell mediated immunity | NAS | 8180467 | |
| GO:0007165 | signal transduction | NAS | 8180467 | |
| GO:0006974 | response to DNA damage stimulus | IDA | 17525332 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005615 | extracellular space | NAS | 8180467 | |
| GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 TTD UP | 64 | 39 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND UP | 77 | 52 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 10HR UP | 101 | 69 | All SZGR 2.0 genes in this pathway |
| KAYO CALORIE RESTRICTION MUSCLE UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-330 | 100 | 106 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.