Gene Page: HIVEP1
Summary ?
| GeneID | 3096 |
| Symbol | HIVEP1 |
| Synonyms | CIRIP|CRYBP1|GAAP|MBP-1|PRDII-BF1|Schnurri-1|ZAS1|ZNF40|ZNF40A |
| Description | human immunodeficiency virus type I enhancer binding protein 1 |
| Reference | MIM:194540|HGNC:HGNC:4920|Ensembl:ENSG00000095951|HPRD:01925|Vega:OTTHUMG00000014265 |
| Gene type | protein-coding |
| Map location | 6p24-p22.3 |
| Pascal p-value | 0.012 |
| Fetal beta | 0.161 |
| DMG | 1 (# studies) |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0159 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| HIVEP1 | chr6 | 12120804 | G | T | NM_002114 | p.259C>F | missense | Schizophrenia | DNM:Gulsuner_2013 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg16797244 | 6 | 12013002 | HIVEP1 | 3.263E-4 | -0.376 | 0.04 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | TAS | 2106471 | |
| GO:0005515 | protein binding | IPI | 16713569 | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | TAS | 2106471 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES CORE NINE CORRELATED | 100 | 68 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND UP | 77 | 52 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| LABBE TGFB1 TARGETS UP | 102 | 64 | All SZGR 2.0 genes in this pathway |
| LINDSTEDT DENDRITIC CELL MATURATION B | 53 | 36 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 190 | 196 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-218 | 73 | 79 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-25/32/92/363/367 | 111 | 117 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-381 | 176 | 182 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-410 | 258 | 264 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-433-3p | 116 | 123 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| miR-494 | 507 | 514 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-496 | 400 | 406 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.