Gene Page: HNRNPC
Summary ?
GeneID | 3183 |
Symbol | HNRNPC |
Synonyms | C1|C2|HNRNP|HNRPC|SNRPC |
Description | heterogeneous nuclear ribonucleoprotein C (C1/C2) |
Reference | MIM:164020|HGNC:HGNC:5035|Ensembl:ENSG00000092199|HPRD:01243|Vega:OTTHUMG00000170757 |
Gene type | protein-coding |
Map location | 14q11.2 |
Pascal p-value | 0.244 |
Sherlock p-value | 0.014 |
Fetal beta | 0.485 |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.047 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003723 | RNA binding | NAS | 9731529 | |
GO:0042802 | identical protein binding | IPI | 16189514 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
GO:0000398 | nuclear mRNA splicing, via spliceosome | IC | 9731529 | |
GO:0008380 | RNA splicing | TAS | 3110598 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005681 | spliceosome | IDA | 9731529 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AP1M1 | AP47 | CLAPM2 | CLTNM | MU-1A | adaptor-related protein complex 1, mu 1 subunit | Two-hybrid | BioGRID | 16189514 |
CCDC85B | DIPA | coiled-coil domain containing 85B | Two-hybrid | BioGRID | 16189514 |
CNBP | CNBP1 | DM2 | FLJ11631 | PROMM | RNF163 | ZCCHC22 | ZNF9 | CCHC-type zinc finger, nucleic acid binding protein | Affinity Capture-MS | BioGRID | 17353931 |
FXR2 | FMR1L2 | fragile X mental retardation, autosomal homolog 2 | Two-hybrid | BioGRID | 16189514 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 9516488 |
HNRNPC | C1 | C2 | HNRNP | HNRPC | MGC104306 | MGC105117 | MGC117353 | MGC131677 | SNRPC | heterogeneous nuclear ribonucleoprotein C (C1/C2) | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 10772858 |16189514 |
KPNA3 | IPOA4 | SRP1gamma | SRP4 | hSRP1 | karyopherin alpha 3 (importin alpha 4) | Two-hybrid | BioGRID | 16189514 |
KRAS | C-K-RAS | K-RAS2A | K-RAS2B | K-RAS4A | K-RAS4B | KI-RAS | KRAS1 | KRAS2 | NS3 | RASK2 | v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog | Two-hybrid | BioGRID | 16189514 |
LMO3 | DAT1 | MGC26081 | RBTN3 | RBTNL2 | RHOM3 | Rhom-3 | LIM domain only 3 (rhombotin-like 2) | Two-hybrid | BioGRID | 16189514 |
MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | Affinity Capture-MS | BioGRID | 17353931 |
PDGFB | FLJ12858 | PDGF2 | SIS | SSV | c-sis | platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) | - | HPRD | 10409733 |
PHKB | DKFZp781E15103 | FLJ41698 | phosphorylase kinase, beta | Two-hybrid | BioGRID | 16189514 |
PIN1 | DOD | UBL5 | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 | Two-hybrid | BioGRID | 16189514 |
PUF60 | FIR | FLJ31379 | RoBPI | SIAHBP1 | poly-U binding splicing factor 60KDa | Affinity Capture-MS | BioGRID | 17353931 |
RALYL | HNRPCL3 | RALY RNA binding protein-like | Two-hybrid | BioGRID | 16189514 |
RBM41 | FLJ11016 | FLJ13670 | bB383K5.1 | RNA binding motif protein 41 | Two-hybrid | BioGRID | 16189514 |
SFRS12 | DKFZp564B176 | MGC133045 | SRrp508 | SRrp86 | splicing factor, arginine/serine-rich 12 | - | HPRD | 14559993 |
UBE2I | C358B7.1 | P18 | UBC9 | ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) | Two-hybrid | BioGRID | 16189514 |
ZNF581 | FLJ22550 | HSPC189 | zinc finger protein 581 | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND UP | 77 | 52 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO CANTHARIDIN DN | 69 | 46 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
KYNG ENVIRONMENTAL STRESS RESPONSE NOT BY 4NQO IN WS | 40 | 26 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
KYNG ENVIRONMENTAL STRESS RESPONSE DN | 21 | 12 | All SZGR 2.0 genes in this pathway |
STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
GRADE COLON VS RECTAL CANCER UP | 38 | 21 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
YOSHIOKA LIVER CANCER EARLY RECURRENCE UP | 40 | 23 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S2 | 115 | 74 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 | 76 | 46 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
KUMAR PATHOGEN LOAD BY MACROPHAGES | 275 | 155 | All SZGR 2.0 genes in this pathway |
KUMAR AUTOPHAGY NETWORK | 71 | 46 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-208 | 553 | 559 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-224 | 254 | 260 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-299-5p | 650 | 656 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-320 | 411 | 417 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-455 | 1 | 7 | 1A | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
miR-499 | 552 | 559 | 1A,m8 | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.