SZGR2

Summary ?

GeneID	320
Symbol	APBA1
Synonyms	D9S411E\|LIN10\|MINT1\|X11\|X11A\|X11ALPHA
Description	amyloid beta precursor protein binding family A member 1
Reference	MIM:602414\|HGNC:HGNC:578\|Ensembl:ENSG00000107282\|HPRD:03879\|Vega:OTTHUMG00000019984
Gene type	protein-coding
Map location	9q21.12
Pascal p-value	0.004
Fetal beta	-0.469
Support	CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DSTYK	0.85	0.87
TRAPPC10	0.84	0.86
BACE1	0.83	0.86
HLCS	0.82	0.85
DYNC1LI2	0.82	0.83
CDC42BPA	0.82	0.85
TGOLN2	0.82	0.85
GRB10	0.82	0.82
C9orf5	0.81	0.84
KIAA0232	0.81	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.59	-0.53
C1orf54	-0.56	-0.56
C1orf61	-0.55	-0.59
GNG11	-0.53	-0.50
VAMP5	-0.53	-0.47
IL32	-0.52	-0.49
MT-CO2	-0.51	-0.49
ENHO	-0.51	-0.52
AF347015.31	-0.51	-0.49
C16orf74	-0.51	-0.53

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		8887653
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9753324
GO:0008088	axon cargo transport	TAS	axon (GO term level: 8)	9822620
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	9753324
GO:0007155	cell adhesion	TAS		9753324
GO:0006461	protein complex assembly	TAS		9614075 \|9753324
GO:0006886	intracellular protein transport	TAS		9614075
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008021	synaptic vesicle	TAS	Synap, Neurotransmitter (GO term level: 12)	9753324

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APBB1	FE65 \| MGC:9072 \| RIR	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	X11alpha interacts with APP.	BIND	11115513
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD,BioGRID	8887653
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	APPswe interacts with X11-alpha.	BIND	12849748 \|14756819
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	Beta-APP interacts with X11.	BIND	8887653
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	X11-ALPHA interacts with Lin-2.	BIND	9822620
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	-	HPRD,BioGRID	9753324 \|9822620 \|9952408\|9822620 \|9952408
CCS	MGC138260	copper chaperone for superoxide dismutase	-	HPRD,BioGRID	11115513
CCS	MGC138260	copper chaperone for superoxide dismutase	X11alpha interacts with CCS.	BIND	11115513
CNTNAP3	CASPR3 \| CNTNAP3A \| RP11-138L21.1 \| RP11-290L7.1	contactin associated protein-like 3	-	HPRD,BioGRID	12093160
CNTNAP4	CASPR4 \| KIAA1763	contactin associated protein-like 4	-	HPRD,BioGRID	12093160
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	14960569
HTR2C	5-HT2C \| 5-HTR2C \| HTR1C	5-hydroxytryptamine (serotonin) receptor 2C	-	HPRD,BioGRID	12006486
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	14960569 \|15024025
KIF17	KIAA1405 \| KIF17B \| KIF3X	kinesin family member 17	-	HPRD	12514209
LIN7A	LIN-7A \| LIN7 \| MALS-1 \| MGC148143 \| TIP-33 \| VELI1	lin-7 homolog A (C. elegans)	Affinity Capture-Western	BioGRID	9822620
LIN7B	LIN-7B \| MALS-2 \| MALS2 \| VELI2	lin-7 homolog B (C. elegans)	-	HPRD,BioGRID	9753324
LIN7C	FLJ11215 \| LIN-7-C \| LIN-7C \| MALS-3 \| MALS3 \| VELI3	lin-7 homolog C (C. elegans)	Affinity Capture-Western	BioGRID	14960569
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	Notch1 interacts with X11-alpha. This interaction was modelled on a demonstrated interaction between mouse Notch1 and human X11-alpha.	BIND	14756819
NRXN1	DKFZp313P2036 \| FLJ35941 \| Hs.22998 \| KIAA0578	neurexin 1	-	HPRD,BioGRID	11036064
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	-	HPRD	12196555
PSEN2	AD3L \| AD4 \| PS2 \| STM2	presenilin 2 (Alzheimer disease 4)	Affinity Capture-Western	BioGRID	12196555
STX1A	HPC-1 \| STX1 \| p35-1	syntaxin 1A (brain)	-	HPRD	9395480
STXBP1	EIEE4 \| MUNC18-1 \| UNC18 \| hUNC18 \| rbSec1	syntaxin binding protein 1	-	HPRD	9395480

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP	27	20	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN	69	48	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	60	66	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	60	66	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-185	152	158	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-24	533	540	1A,m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: APBA1