SZGR2

Summary ?

GeneID	324
Symbol	APC
Synonyms	BTPS2\|DP2\|DP2.5\|DP3\|GS\|PPP1R46
Description	adenomatous polyposis coli
Reference	MIM:611731\|HGNC:HGNC:583\|Ensembl:ENSG00000134982\|HPRD:01439\|Vega:OTTHUMG00000128806
Gene type	protein-coding
Map location	5q21-q22
Pascal p-value	0.072
Sherlock p-value	0.045
Fetal beta	1.038
DMG	2 (# studies)
eGene	Meta
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0228

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg16970232	5	112073433	APC		-0.027	0.25	DMG:Nishioka_2013
cg16481008	5	112043117	APC	2.29E-9	-0.012	1.74E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
UQCRC1	0.88	0.85
NIT1	0.87	0.83
ARFIP2	0.87	0.83
ATP5B	0.87	0.82
TBRG4	0.86	0.84
MRPL37	0.86	0.82
NDUFA10	0.86	0.81
SLC41A3	0.85	0.81
PREB	0.85	0.83
RABGGTA	0.85	0.81

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.18	-0.62	-0.57
AF347015.21	-0.61	-0.50
AF347015.8	-0.61	-0.49
AL139819.3	-0.60	-0.59
AF347015.2	-0.59	-0.46
AF347015.26	-0.59	-0.49
MT-CO2	-0.58	-0.46
MT-ATP8	-0.57	-0.52
AF347015.33	-0.56	-0.48
MT-CYB	-0.56	-0.47

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008605	protein kinase CK2 regulator activity	IDA		11972058
GO:0008017	microtubule binding	IDA		11166179 \|16188939
GO:0008013	beta-catenin binding	IPI		11533658
GO:0008013	beta-catenin binding	NAS		8259518
GO:0019901	protein kinase binding	IDA		11283619
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	NAS		8259518
GO:0006461	protein complex assembly	IDA		16188939
GO:0007026	negative regulation of microtubule depolymerization	IDA		11166179
GO:0009953	dorsal/ventral pattern formation	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0007050	cell cycle arrest	IDA		8521819
GO:0008285	negative regulation of cell proliferation	IDA		8521819
GO:0009798	axis specification	IEA		-
GO:0006974	response to DNA damage stimulus	IDA		14728717
GO:0045736	negative regulation of cyclin-dependent protein kinase activity	IDA		8521819
GO:0051988	regulation of attachment of spindle microtubules to kinetochore	NAS		11283619
GO:0060070	Wnt receptor signaling pathway through beta-catenin	IC		9601641
GO:0060070	Wnt receptor signaling pathway through beta-catenin	NAS		11035805
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000776	kinetochore	IDA		11283619
GO:0005813	centrosome	IDA		11283619
GO:0005829	cytosol	EXP		11955436 \|12000790 \|12820959 \|15327769 \|16753179
GO:0005634	nucleus	IDA		11035805 \|12955080
GO:0005737	cytoplasm	IDA		11035805 \|12955080
GO:0016328	lateral plasma membrane	IDA		12072559
GO:0030877	beta-catenin destruction complex	IDA		9601641 \|16188939

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APC	BTPS2 \| DP2 \| DP2.5 \| DP3 \| GS	adenomatous polyposis coli	Affinity Capture-Western Reconstituted Complex	BioGRID	8389242 \|12070164
ARHGEF4	ASEF \| ASEF1 \| GEF4 \| STM6	Rho guanine nucleotide exchange factor (GEF) 4	APC interacts with Asef. This interaction was modeled on a demonstrated interaction between human APC and Asef from an unspecified species.	BIND	15572129
ARHGEF4	ASEF \| ASEF1 \| GEF4 \| STM6	Rho guanine nucleotide exchange factor (GEF) 4	-	HPRD,BioGRID	10947987
AXIN1	AXIN \| MGC52315	axin 1	Reconstituted Complex Two-hybrid	BioGRID	9734785
AXIN1	AXIN \| MGC52315	axin 1	-	HPRD	11297546
AXIN2	AXIL \| DKFZp781B0869 \| MGC10366 \| MGC126582	axin 2	-	HPRD,BioGRID	10966653
BUB1	BUB1A \| BUB1L \| hBUB1	budding uninhibited by benzimidazoles 1 homolog (yeast)	-	HPRD,BioGRID	11283619
BUB1B	BUB1beta \| BUBR1 \| Bub1A \| MAD3L \| SSK1 \| hBUBR1	budding uninhibited by benzimidazoles 1 homolog beta (yeast)	Biochemical Activity	BioGRID	11283619
BUB3	BUB3L \| hBUB3	budding uninhibited by benzimidazoles 3 homolog (yeast)	Affinity Capture-Western	BioGRID	11283619
CDC20	CDC20A \| MGC102824 \| bA276H19.3 \| p55CDC	cell division cycle 20 homolog (S. cerevisiae)	-	HPRD	9637688 \|9811605
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Affinity Capture-Western Reconstituted Complex	BioGRID	11972058
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	Affinity Capture-Western	BioGRID	11972058
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	CtBP interacts with APC.	BIND	15525529
CTNNA1	CAP102 \| FLJ36832	catenin (cadherin-associated protein), alpha 1, 102kDa	Affinity Capture-Western	BioGRID	7651399 \|8259519
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	APC interacts with Beta-catenin.	BIND	15525529
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD	12000790
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Beta-catenin interacts with APC. This interaction was modelled on a demonstrated interaction between human beta-catenin and mouse Apc.	BIND	15294866
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western Co-crystal Structure Far Western Reconstituted Complex	BioGRID	8259519 \|9286858 \|11251183 \|11533658 \|11707392 \|11712088 \|11972058 \|12628243
DLG3	KIAA1232 \| MRX \| MRX90 \| NE-Dlg \| NEDLG \| SAP102	discs, large homolog 3 (neuroendocrine-dlg, Drosophila)	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9188857
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	-	HPRD,BioGRID	9286858
GSK3B	-	glycogen synthase kinase 3 beta	Affinity Capture-Western	BioGRID	11251183
IQGAP1	HUMORFA01 \| KIAA0051 \| SAR1 \| p195	IQ motif containing GTPase activating protein 1	APC interacts with IQGAP1.	BIND	15572129
JUP	ARVD12 \| CTNNG \| DP3 \| DPIII \| PDGB \| PKGB	junction plakoglobin	Affinity Capture-Western Reconstituted Complex	BioGRID	7651399 \|8074697
KIFAP3	FLJ22818 \| KAP3 \| SMAP \| Smg-GDS \| dJ190I16.1	kinesin-associated protein 3	-	HPRD,BioGRID	11912492
MAD2L1	HSMAD2 \| MAD2	MAD2 mitotic arrest deficient-like 1 (yeast)	-	HPRD,BioGRID	9637688
MAPRE1	EB1 \| MGC117374 \| MGC129946	microtubule-associated protein, RP/EB family, member 1	-	HPRD,BioGRID	11470413 \|12388762
MAPRE2	EB1 \| EB2 \| RP1	microtubule-associated protein, RP/EB family, member 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	7606712 \|11470413
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	Affinity Capture-Western	BioGRID	15020226
PPP2R5A	B56A \| MGC131915 \| PR61A	protein phosphatase 2, regulatory subunit B', alpha isoform	Co-localization	BioGRID	11585828
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD	7744883
PTPN13	DKFZp686J1497 \| FAP-1 \| PNP1 \| PTP-BAS \| PTP-BL \| PTP1E \| PTPL1 \| PTPLE	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	Affinity Capture-Western Two-hybrid	BioGRID	10951583
RP1	DCDC4A \| ORP1	retinitis pigmentosa 1 (autosomal dominant)	-	HPRD	10188731
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SIAH1	FLJ08065 \| HUMSIAH \| Siah-1 \| Siah-1a \| hSIAH1	seven in absentia homolog 1 (Drosophila)	-	HPRD,BioGRID	11389840
TFAP2A	AP-2 \| AP-2alpha \| AP2TF \| BOFS \| TFAP2	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	Affinity Capture-Western Reconstituted Complex	BioGRID	15331612
TUBA4A	FLJ30169 \| H2-ALPHA \| TUBA1	tubulin, alpha 4a	Co-localization Reconstituted Complex	BioGRID	11166179
XPO1	CRM1 \| DKFZp686B1823	exportin 1 (CRM1 homolog, yeast)	Affinity Capture-Western Reconstituted Complex	BioGRID	12070164

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
BIOCARTA GSK3 PATHWAY	27	26	All SZGR 2.0 genes in this pathway
BIOCARTA PITX2 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY	14	14	All SZGR 2.0 genes in this pathway
BIOCARTA TGFB PATHWAY	19	14	All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY	26	24	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
ST GRANULE CELL SURVIVAL PATHWAY	27	23	All SZGR 2.0 genes in this pathway
ST ADRENERGIC	36	29	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
ST MYOCYTE AD PATHWAY	27	25	All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY	18	17	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID CDC42 REG PATHWAY	30	22	All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY	20	18	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS	40	26	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY WNT	65	41	All SZGR 2.0 genes in this pathway
REACTOME CTNNB1 PHOSPHORYLATION CASCADE	16	11	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC EXECUTION PHASE	54	37	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING DN	58	35	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP	191	128	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION UP	88	58	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 3	48	31	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 27	15	8	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE DN	33	22	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 7	27	22	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED FREQUENTLY	12	10	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER UP	49	36	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP	64	46	All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS DIRECT DN	14	7	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND H2O2	39	29	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1	58	43	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL SHORT TERM	32	15	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 UP	84	55	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN	165	106	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C3	14	10	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER DN	28	26	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
HOQUE METHYLATED IN CANCER	56	45	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER UP	38	26	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA	43	27	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS UP	74	45	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
LI PROSTATE CANCER EPIGENETIC	30	22	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 DN	69	38	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	382	388	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	382	388	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-129-5p	404	411	1A,m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	404	411	1A,m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-142-3p	310	317	1A,m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-153	961	967	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-153	961	967	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-155	965	971	1A	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-203.1	822	829	1A,m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-26	1248	1255	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1248	1255	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	462	468	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	462	468	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-3p	859	865	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	859	865	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-330	511	517	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-374	359	365	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-381	741	747	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-448	401	407	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	404	410	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-496	847	853	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: APC