Gene Page: C17orf97
Summary ?
GeneID | 400566 |
Symbol | C17orf97 |
Synonyms | CK20|LIAT1 |
Description | chromosome 17 open reading frame 97 |
Reference | HGNC:HGNC:33800|Ensembl:ENSG00000187624|HPRD:18416|Vega:OTTHUMG00000132479 |
Gene type | protein-coding |
Map location | 17p13.3 |
Pascal p-value | 0.644 |
eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Meta |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
C17orf97 | chr17 | 263585..263645 | TGACCCCGAGGCCCTCAAGGGCTTCCACCCCGACCCCAAGGCCCTCAAGGGCTTCCACCCC | T | NM_001013672 | . | codon-deletion | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs8066059 | 17 | 242173 | C17orf97 | ENSG00000187624.7 | 1.926E-9 | 0 | -17945 | gtex_brain_ba24 |
rs10871516 | 17 | 245185 | C17orf97 | ENSG00000187624.7 | 3.599E-9 | 0 | -14933 | gtex_brain_ba24 |
rs4985598 | 17 | 246162 | C17orf97 | ENSG00000187624.7 | 3.832E-8 | 0 | -13956 | gtex_brain_ba24 |
rs4567793 | 17 | 248856 | C17orf97 | ENSG00000187624.7 | 4.467E-11 | 0 | -11262 | gtex_brain_ba24 |
rs12941905 | 17 | 250234 | C17orf97 | ENSG00000187624.7 | 1.314E-11 | 0 | -9884 | gtex_brain_ba24 |
rs138751309 | 17 | 251216 | C17orf97 | ENSG00000187624.7 | 1.465E-12 | 0 | -8902 | gtex_brain_ba24 |
rs201937859 | 17 | 251222 | C17orf97 | ENSG00000187624.7 | 7.294E-11 | 0 | -8896 | gtex_brain_ba24 |
rs78566138 | 17 | 251223 | C17orf97 | ENSG00000187624.7 | 1.436E-10 | 0 | -8895 | gtex_brain_ba24 |
rs28380314 | 17 | 252628 | C17orf97 | ENSG00000187624.7 | 1.075E-12 | 0 | -7490 | gtex_brain_ba24 |
rs12949755 | 17 | 258807 | C17orf97 | ENSG00000187624.7 | 4.521E-9 | 0 | -1311 | gtex_brain_ba24 |
rs11150881 | 17 | 259304 | C17orf97 | ENSG00000187624.7 | 1.445E-14 | 0 | -814 | gtex_brain_ba24 |
rs11150882 | 17 | 259648 | C17orf97 | ENSG00000187624.7 | 1.445E-14 | 0 | -470 | gtex_brain_ba24 |
rs7503725 | 17 | 260142 | C17orf97 | ENSG00000187624.7 | 1.643E-14 | 0 | 24 | gtex_brain_ba24 |
rs7502594 | 17 | 260182 | C17orf97 | ENSG00000187624.7 | 1.445E-14 | 0 | 64 | gtex_brain_ba24 |
rs34637009 | 17 | 260909 | C17orf97 | ENSG00000187624.7 | 4.232E-9 | 0 | 791 | gtex_brain_ba24 |
rs35067709 | 17 | 262555 | C17orf97 | ENSG00000187624.7 | 1.55E-12 | 0 | 2437 | gtex_brain_ba24 |
rs35229416 | 17 | 263294 | C17orf97 | ENSG00000187624.7 | 6.414E-11 | 0 | 3176 | gtex_brain_ba24 |
rs77314934 | 17 | 263441 | C17orf97 | ENSG00000187624.7 | 1.652E-7 | 0 | 3323 | gtex_brain_ba24 |
rs200368490 | 17 | 265173 | C17orf97 | ENSG00000187624.7 | 1.326E-9 | 0 | 5055 | gtex_brain_ba24 |
rs62053092 | 17 | 265980 | C17orf97 | ENSG00000187624.7 | 1.646E-12 | 0 | 5862 | gtex_brain_ba24 |
rs62053093 | 17 | 267793 | C17orf97 | ENSG00000187624.7 | 1.775E-12 | 0 | 7675 | gtex_brain_ba24 |
rs6565724 | 17 | 270933 | C17orf97 | ENSG00000187624.7 | 9.818E-12 | 0 | 10815 | gtex_brain_ba24 |
rs7501541 | 17 | 271153 | C17orf97 | ENSG00000187624.7 | 2.798E-12 | 0 | 11035 | gtex_brain_ba24 |
rs6565721 | 17 | 241190 | C17orf97 | ENSG00000187624.7 | 1.882E-9 | 0 | -18928 | gtex_brain_putamen_basal |
rs8066059 | 17 | 242173 | C17orf97 | ENSG00000187624.7 | 6.236E-9 | 0 | -17945 | gtex_brain_putamen_basal |
rs10871516 | 17 | 245185 | C17orf97 | ENSG00000187624.7 | 2.425E-9 | 0 | -14933 | gtex_brain_putamen_basal |
rs4985598 | 17 | 246162 | C17orf97 | ENSG00000187624.7 | 1.032E-8 | 0 | -13956 | gtex_brain_putamen_basal |
rs4567793 | 17 | 248856 | C17orf97 | ENSG00000187624.7 | 7.483E-12 | 0 | -11262 | gtex_brain_putamen_basal |
rs12941905 | 17 | 250234 | C17orf97 | ENSG00000187624.7 | 4.268E-10 | 0 | -9884 | gtex_brain_putamen_basal |
rs138751309 | 17 | 251216 | C17orf97 | ENSG00000187624.7 | 1.492E-11 | 0 | -8902 | gtex_brain_putamen_basal |
rs201937859 | 17 | 251222 | C17orf97 | ENSG00000187624.7 | 5.72E-10 | 0 | -8896 | gtex_brain_putamen_basal |
rs78566138 | 17 | 251223 | C17orf97 | ENSG00000187624.7 | 3.19E-9 | 0 | -8895 | gtex_brain_putamen_basal |
rs28380314 | 17 | 252628 | C17orf97 | ENSG00000187624.7 | 4.155E-12 | 0 | -7490 | gtex_brain_putamen_basal |
rs12949755 | 17 | 258807 | C17orf97 | ENSG00000187624.7 | 2.578E-7 | 0 | -1311 | gtex_brain_putamen_basal |
rs11150881 | 17 | 259304 | C17orf97 | ENSG00000187624.7 | 6.122E-14 | 0 | -814 | gtex_brain_putamen_basal |
rs11150882 | 17 | 259648 | C17orf97 | ENSG00000187624.7 | 6.122E-14 | 0 | -470 | gtex_brain_putamen_basal |
rs7503725 | 17 | 260142 | C17orf97 | ENSG00000187624.7 | 7.537E-14 | 0 | 24 | gtex_brain_putamen_basal |
rs7502594 | 17 | 260182 | C17orf97 | ENSG00000187624.7 | 6.122E-14 | 0 | 64 | gtex_brain_putamen_basal |
rs12951902 | 17 | 260747 | C17orf97 | ENSG00000187624.7 | 1.591E-7 | 0 | 629 | gtex_brain_putamen_basal |
rs12951915 | 17 | 260762 | C17orf97 | ENSG00000187624.7 | 1.613E-7 | 0 | 644 | gtex_brain_putamen_basal |
rs34637009 | 17 | 260909 | C17orf97 | ENSG00000187624.7 | 4.478E-9 | 0 | 791 | gtex_brain_putamen_basal |
rs35067709 | 17 | 262555 | C17orf97 | ENSG00000187624.7 | 1.497E-11 | 0 | 2437 | gtex_brain_putamen_basal |
rs35229416 | 17 | 263294 | C17orf97 | ENSG00000187624.7 | 4.694E-10 | 0 | 3176 | gtex_brain_putamen_basal |
rs77314934 | 17 | 263441 | C17orf97 | ENSG00000187624.7 | 1.382E-7 | 0 | 3323 | gtex_brain_putamen_basal |
rs74991980 | 17 | 263494 | C17orf97 | ENSG00000187624.7 | 2.299E-8 | 0 | 3376 | gtex_brain_putamen_basal |
rs200368490 | 17 | 265173 | C17orf97 | ENSG00000187624.7 | 2.524E-9 | 0 | 5055 | gtex_brain_putamen_basal |
rs201775888 | 17 | 265263 | C17orf97 | ENSG00000187624.7 | 9.246E-7 | 0 | 5145 | gtex_brain_putamen_basal |
rs62053092 | 17 | 265980 | C17orf97 | ENSG00000187624.7 | 1.165E-11 | 0 | 5862 | gtex_brain_putamen_basal |
rs62053093 | 17 | 267793 | C17orf97 | ENSG00000187624.7 | 1.276E-11 | 0 | 7675 | gtex_brain_putamen_basal |
rs6565724 | 17 | 270933 | C17orf97 | ENSG00000187624.7 | 1.139E-11 | 0 | 10815 | gtex_brain_putamen_basal |
rs7501541 | 17 | 271153 | C17orf97 | ENSG00000187624.7 | 9.259E-12 | 0 | 11035 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |