Gene Page: CAPRIN1
Summary ?
GeneID | 4076 |
Symbol | CAPRIN1 |
Synonyms | GPIAP1|GPIP137|GRIP137|M11S1|RNG105|p137GPI |
Description | cell cycle associated protein 1 |
Reference | MIM:601178|HGNC:HGNC:6743|Ensembl:ENSG00000135387|HPRD:03108|Vega:OTTHUMG00000166248 |
Gene type | protein-coding |
Map location | 11p13 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.721 |
Fetal beta | 1.461 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg26801843 | 11 | 34073061 | CAPRIN1 | 1.64E-9 | -0.011 | 1.47E-6 | DMG:Jaffe_2016 |
cg05533552 | 11 | 34074141 | CAPRIN1 | 4.22E-8 | -0.021 | 1.17E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 7657653 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
SEIDEN MET SIGNALING | 19 | 16 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C1 | 72 | 45 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G123 UP | 45 | 21 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
MIKHAYLOVA OXIDATIVE STRESS RESPONSE VIA VHL UP | 7 | 6 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1699 | 1706 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-136 | 1491 | 1497 | 1A | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
miR-145 | 1648 | 1654 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-19 | 229 | 235 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-193 | 41 | 47 | m8 | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-199 | 36 | 42 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-204/211 | 112 | 118 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-330 | 671 | 677 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-378 | 96 | 102 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-409-3p | 1706 | 1712 | 1A | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-496 | 611 | 618 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.