SZGR2

Summary ?

GeneID	4137
Symbol	MAPT
Synonyms	DDPAC\|FTDP-17\|MAPTL\|MSTD\|MTBT1\|MTBT2\|PPND\|PPP1R103\|TAU
Description	microtubule associated protein tau
Reference	MIM:157140\|HGNC:HGNC:6893\|Ensembl:ENSG00000186868\|HPRD:01142\|Vega:OTTHUMG00000168833
Gene type	protein-coding
Map location	17q21.1
Sherlock p-value	0.004
Fetal beta	-2.487
eGene	Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Myers' cis & trans Meta
Support	STRUCTURAL PLASTICITY G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
CV:PheWAS	Phenome-wide association studies (PheWAS)	157 SNPs associated with schizophrenia	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 8
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 3.6916

Section I. Genetics and epigenetics annotation

CV:PheWAS

SNP ID	Chromosome	Position	Allele	P	Function	Gene	Up/Down Distance
rs242557	17	0	null	1.576	MAPT	null

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12947718	chr17	43493100	MAPT	4137	0	cis
rs17631303	chr17	43516401	MAPT	4137	0	cis
rs3946526	chr17	43541655	MAPT	4137	1.764E-4	cis
rs2696425	chr17	43666905	MAPT	4137	8.37E-4	cis
rs418891	chr17	43693537	MAPT	4137	0	cis
rs413778	chr17	43716884	MAPT	4137	0	cis
rs453997	chr17	43727060	MAPT	4137	5.899E-4	cis
rs422112	chr17	43728136	MAPT	4137	0	cis
rs241033	chr17	43733982	MAPT	4137	5.899E-4	cis
rs241032	chr17	43734144	MAPT	4137	0	cis
rs241031	chr17	43734303	MAPT	4137	5.899E-4	cis
rs17760733	chr17	43746275	MAPT	4137	0.01	cis
rs17687571	chr17	43750009	MAPT	4137	0	cis
rs17687667	chr17	43754098	MAPT	4137	6.42E-4	cis
rs17688002	chr17	43762593	MAPT	4137	5.899E-4	cis
rs17688068	chr17	43763934	MAPT	4137	0.02	cis
rs17688391	chr17	43772108	MAPT	4137	9.156E-4	cis
rs17688434	chr17	43772539	MAPT	4137	0	cis
rs12150610	chr17	43775478	MAPT	4137	0	cis
rs12150547	chr17	43775545	MAPT	4137	5.899E-4	cis
rs17762165	chr17	43778601	MAPT	4137	8.734E-4	cis
rs17688922	chr17	43779350	MAPT	4137	0	cis
rs17688944	chr17	43779418	MAPT	4137	5.878E-4	cis
rs1526128	chr17	43779623	MAPT	4137	7.6E-4	cis
rs1526129	chr17	43779656	MAPT	4137	0	cis
rs1724425	chr17	43781746	MAPT	4137	0.01	cis
rs17563501	chr17	43801694	MAPT	4137	7.043E-4	cis
rs2902662	chr17	43806924	MAPT	4137	0	cis
rs17563787	chr17	43813251	MAPT	4137	5.878E-4	cis
rs17563827	chr17	43818221	MAPT	4137	7.176E-4	cis
rs12150672	chr17	43826636	MAPT	4137	0.01	cis
rs17426106	chr17	43828934	MAPT	4137	5.452E-4	cis
rs17426195	chr17	43832366	MAPT	4137	7.513E-4	cis
rs6503447	chr17	43834911	MAPT	4137	0.06	cis
rs4074462	chr17	43855227	MAPT	4137	0	cis
rs17689471	chr17	43892972	MAPT	4137	7.043E-4	cis
rs17762769	chr17	43893402	MAPT	4137	0	cis
rs171440	chr17	43893486	MAPT	4137	0.08	cis
rs8072451	chr17	43893715	MAPT	4137	0	cis
rs4277389	chr17	43895652	MAPT	4137	5.878E-4	cis
rs17689824	chr17	43904396	MAPT	4137	6.987E-4	cis
rs17763086	chr17	43905480	MAPT	4137	0.02	cis
rs17689882	chr17	43906827	MAPT	4137	5.878E-4	cis
rs17769552	chr17	43927289	MAPT	4137	9.779E-4	cis
rs916793	chr17	43954685	MAPT	4137	7.043E-4	cis
rs17649553	chr17	43994647	MAPT	4137	0	cis
rs17649641	chr17	43997371	MAPT	4137	0	cis
rs17564223	chr17	43997519	MAPT	4137	0	cis
rs17649954	chr17	44001660	MAPT	4137	5.441E-4	cis
rs17564619	chr17	44002137	MAPT	4137	9.354E-4	cis
rs17650063	chr17	44002554	MAPT	4137	7.043E-4	cis
rs17564780	chr17	44005412	MAPT	4137	7.043E-4	cis
rs17650381	chr17	44013023	MAPT	4137	0	cis
rs12150111	chr17	44013937	MAPT	4137	7.043E-4	cis
rs2316784	chr17	44021698	MAPT	4137	8.505E-4	cis
rs4327091	chr17	44021716	MAPT	4137	5.878E-4	cis
rs242559	chr17	44025887	MAPT	4137	0	cis
rs17571718	chr17	44032767	MAPT	4137	4.555E-4	cis
rs17571739	chr17	44032914	MAPT	4137	5.878E-4	cis
rs17650872	chr17	44039515	MAPT	4137	7.043E-4	cis
rs17572169	chr17	44045973	MAPT	4137	5.878E-4	cis
rs17651213	chr17	44051923	MAPT	4137	0.01	cis
rs17572361	chr17	44052008	MAPT	4137	0	cis
rs17572851	chr17	44063765	MAPT	4137	0	cis
rs17572893	chr17	44064207	MAPT	4137	5.878E-4	cis
rs17573175	chr17	44071088	MAPT	4137	8.2E-4	cis
rs1078268	chr17	44075900	MAPT	4137	0	cis
rs8070723	chr17	44081063	MAPT	4137	5.878E-4	cis
rs17652449	chr17	44088936	MAPT	4137	0	cis
rs17652502	chr17	44094470	MAPT	4137	7.043E-4	cis
rs17574228	chr17	44104508	MAPT	4137	5.878E-4	cis
rs1076222	chr17	44109768	MAPT	4137	0	cis
rs7350980	chr17	44110270	MAPT	4137	0	cis
rs4597358	chr17	44110669	MAPT	4137	5.878E-4	cis
rs17653162	chr17	44111826	MAPT	4137	3.466E-4	cis
rs17574824	chr17	44115106	MAPT	4137	0	cis
rs12150090	chr17	44115885	MAPT	4137	7.043E-4	cis
rs7221390	chr17	44116949	MAPT	4137	7.043E-4	cis
rs17575556	chr17	44135826	MAPT	4137	8.802E-4	cis
rs17659881	chr17	44157596	MAPT	4137	7.043E-4	cis
rs17660132	chr17	44165802	MAPT	4137	3.611E-4	cis
rs17577094	chr17	44187491	MAPT	4137	0	cis
rs17660907	chr17	44191084	MAPT	4137	0	cis
rs8070942	chr17	44208673	MAPT	4137	5.515E-4	cis
rs2532316	chr17	44213711	MAPT	4137	5.878E-4	cis
rs2696600	chr17	44216225	MAPT	4137	0	cis
rs1406068	chr17	44234525	MAPT	4137	5.878E-4	cis
rs2532292	chr17	44237067	MAPT	4137	7.043E-4	cis
rs2532286	chr17	44241663	MAPT	4137	7.544E-4	cis
rs2532276	chr17	44246623	MAPT	4137	0	cis
rs2532275	chr17	44246996	MAPT	4137	7.043E-4	cis
rs2532259	chr17	44253363	MAPT	4137	7.043E-4	cis
rs2732646	chr17	44254378	MAPT	4137	5.878E-4	cis
rs2732589	chr17	44266021	MAPT	4137	0	cis
rs1918788	chr17	44267616	MAPT	4137	7.043E-4	cis
rs2732596	chr17	44269545	MAPT	4137	0.01	cis
rs2732675	chr17	44280187	MAPT	4137	0	cis
rs2732674	chr17	44280696	MAPT	4137	0.01	cis
rs2668695	chr17	44292125	MAPT	4137	6.7E-4	cis
rs2532332	chr17	44347726	MAPT	4137	0.08	cis
rs2732706	chr17	44351685	MAPT	4137	0	cis
rs2668624	chr17	44352871	MAPT	4137	0.01	cis
rs199436	chr17	44789284	MAPT	4137	0.17	cis
rs142167	chr17	44795233	MAPT	4137	0.12	cis
rs199452	chr17	44801339	MAPT	4137	0.13	cis
rs199449	chr17	44808901	MAPT	4137	0.15	cis
rs199535	chr17	44822661	MAPT	4137	0.04	cis
rs199515	chr17	44856640	MAPT	4137	0.1	cis
rs12947718	chr17	43493100	MAPT	4137	0.17	trans
rs17631303	chr17	43516401	MAPT	4137	0.1	trans
rs3946526	chr17	43541655	MAPT	4137	0.02	trans
rs2696425	chr17	43666905	MAPT	4137	0.06	trans
rs418891	chr17	43693537	MAPT	4137	0.17	trans
rs413778	chr17	43716884	MAPT	4137	0.13	trans
rs453997	chr17	43727060	MAPT	4137	0.05	trans
rs422112	chr17	43728136	MAPT	4137	0.13	trans
rs241033	chr17	43733982	MAPT	4137	0.05	trans
rs241031	chr17	43734303	MAPT	4137	0.05	trans
rs17687571	chr17	43750009	MAPT	4137	0.18	trans
rs17687667	chr17	43754098	MAPT	4137	0.05	trans
rs17688002	chr17	43762593	MAPT	4137	0.05	trans
rs17688391	chr17	43772108	MAPT	4137	0.07	trans
rs17688434	chr17	43772539	MAPT	4137	0.11	trans
rs12150610	chr17	43775478	MAPT	4137	0.1	trans
rs12150547	chr17	43775545	MAPT	4137	0.05	trans
rs17762165	chr17	43778601	MAPT	4137	0.06	trans
rs17688922	chr17	43779350	MAPT	4137	0.07	trans
rs17688944	chr17	43779418	MAPT	4137	0.05	trans
rs1526128	chr17	43779623	MAPT	4137	0.06	trans
rs1526129	chr17	43779656	MAPT	4137	0.08	trans
rs17563501	chr17	43801694	MAPT	4137	0.05	trans
rs2902662	chr17	43806924	MAPT	4137	0.1	trans
rs17563787	chr17	43813251	MAPT	4137	0.05	trans
rs17563827	chr17	43818221	MAPT	4137	0.05	trans
rs17426106	chr17	43828934	MAPT	4137	0.04	trans
rs17426195	chr17	43832366	MAPT	4137	0.06	trans
rs4074462	chr17	43855227	MAPT	4137	0.09	trans
rs17689471	chr17	43892972	MAPT	4137	0.05	trans
rs17762769	chr17	43893402	MAPT	4137	0.1	trans
rs8072451	chr17	43893715	MAPT	4137	0.08	trans
rs4277389	chr17	43895652	MAPT	4137	0.05	trans
rs17689824	chr17	43904396	MAPT	4137	0.05	trans
rs17769552	chr17	43927289	MAPT	4137	0.07	trans
snp_a-2150382		0	MAPT	4137	0.04	trans
rs916793	chr17	43954685	MAPT	4137	0.05	trans
rs17649553	chr17	43994647	MAPT	4137	0.09	trans
rs17649641	chr17	43997371	MAPT	4137	0.17	trans
rs17564223	chr17	43997519	MAPT	4137	0.09	trans
rs17649954	chr17	44001660	MAPT	4137	0.04	trans
rs17564619	chr17	44002137	MAPT	4137	0.07	trans
rs17650063	chr17	44002554	MAPT	4137	0.05	trans
rs17564780	chr17	44005412	MAPT	4137	0.05	trans
rs17650381	chr17	44013023	MAPT	4137	0.11	trans
rs12150111	chr17	44013937	MAPT	4137	0.05	trans
rs2316784	chr17	44021698	MAPT	4137	0.06	trans
rs4327091	chr17	44021716	MAPT	4137	0.05	trans
rs242559	chr17	44025887	MAPT	4137	0.08	trans
rs17571718	chr17	44032767	MAPT	4137	0.04	trans
rs17571739	chr17	44032914	MAPT	4137	0.05	trans
rs17650872	chr17	44039515	MAPT	4137	0.05	trans
rs17572169	chr17	44045973	MAPT	4137	0.05	trans
rs17572361	chr17	44052008	MAPT	4137	0.18	trans
rs17572851	chr17	44063765	MAPT	4137	0.1	trans
rs17572893	chr17	44064207	MAPT	4137	0.05	trans
rs17573175	chr17	44071088	MAPT	4137	0.06	trans
rs1078268	chr17	44075900	MAPT	4137	0.09	trans
rs8070723	chr17	44081063	MAPT	4137	0.05	trans
rs17652449	chr17	44088936	MAPT	4137	0.15	trans
rs17652502	chr17	44094470	MAPT	4137	0.05	trans
rs17574228	chr17	44104508	MAPT	4137	0.05	trans
rs1076222	chr17	44109768	MAPT	4137	0.09	trans
rs7350980	chr17	44110270	MAPT	4137	0.08	trans
rs4597358	chr17	44110669	MAPT	4137	0.05	trans
rs17653162	chr17	44111826	MAPT	4137	0.03	trans
rs17574824	chr17	44115106	MAPT	4137	0.2	trans
rs12150090	chr17	44115885	MAPT	4137	0.05	trans
snp_a-1855473		0	MAPT	4137	0.05	trans
rs7221390	chr17	44116949	MAPT	4137	0.05	trans
snp_a-1823652		0	MAPT	4137	0.18	trans
rs17575556	chr17	44135826	MAPT	4137	0.06	trans
rs17659881	chr17	44157596	MAPT	4137	0.05	trans
rs17660132	chr17	44165802	MAPT	4137	0.03	trans
rs17577094	chr17	44187491	MAPT	4137	0.15	trans
rs17660907	chr17	44191084	MAPT	4137	0.07	trans
rs8070942	chr17	44208673	MAPT	4137	0.04	trans
rs2532316	chr17	44213711	MAPT	4137	0.05	trans
rs2696600	chr17	44216225	MAPT	4137	0.13	trans
rs1406068	chr17	44234525	MAPT	4137	0.05	trans
rs2532292	chr17	44237067	MAPT	4137	0.05	trans
rs2532286	chr17	44241663	MAPT	4137	0.06	trans
rs2532276	chr17	44246623	MAPT	4137	0.07	trans
rs2532275	chr17	44246996	MAPT	4137	0.05	trans
rs2532259	chr17	44253363	MAPT	4137	0.05	trans
rs2732646	chr17	44254378	MAPT	4137	0.05	trans
rs2732589	chr17	44266021	MAPT	4137	0.16	trans
rs1918788	chr17	44267616	MAPT	4137	0.05	trans
rs2732675	chr17	44280187	MAPT	4137	0.14	trans
rs2668695	chr17	44292125	MAPT	4137	0.05	trans
rs2732706	chr17	44351685	MAPT	4137	0.11	trans
rs2668622		0	MAPT	4137	0.04	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TNS1	0.83	0.86
TLN1	0.80	0.81
RRBP1	0.79	0.83
SLC20A2	0.78	0.82
GSN	0.77	0.78
ANGPTL2	0.77	0.79
TJP2	0.77	0.82
UNC5B	0.77	0.80
MYLK	0.77	0.79
ERBB3	0.77	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NR2C2AP	-0.53	-0.56
RPL27	-0.52	-0.67
RPL31	-0.52	-0.66
POLB	-0.52	-0.58
RPS23	-0.52	-0.66
FRG1	-0.52	-0.61
RPL24	-0.52	-0.68
CYP2R1	-0.52	-0.57
RPS18	-0.52	-0.64
RPL32	-0.51	-0.64

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005200	structural constituent of cytoskeleton	TAS		2498079
GO:0008034	lipoprotein binding	IPI		7972031
GO:0017124	SH3 domain binding	IPI		9763511
GO:0008017	microtubule binding	IDA		1918161
GO:0008017	microtubule binding	ISS		-
GO:0019899	enzyme binding	IPI		9736630 \|12888622
GO:0034187	apolipoprotein E binding	IPI		7566652
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0048699	generation of neurons	NAS	neuron, neurogenesis (GO term level: 7)	8522593
GO:0045773	positive regulation of axon extension	IDA	axon (GO term level: 15)	1389180
GO:0045773	positive regulation of axon extension	ISS	axon (GO term level: 15)	-
GO:0000226	microtubule cytoskeleton organization	IDA		1057175
GO:0000226	microtubule cytoskeleton organization	ISS		-
GO:0007026	negative regulation of microtubule depolymerization	IEA		-
GO:0031116	positive regulation of microtubule polymerization	IDA		1421571
GO:0031116	positive regulation of microtubule polymerization	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042995	cell projection	IEA	axon (GO term level: 4)	-
GO:0030426	growth cone	IDA	axon, dendrite (GO term level: 5)	8642405
GO:0030426	growth cone	ISS	axon, dendrite (GO term level: 5)	-
GO:0030424	axon	IDA	neuron, axon, Neurotransmitter (GO term level: 6)	8642405
GO:0030424	axon	ISS	neuron, axon, Neurotransmitter (GO term level: 6)	-
GO:0005829	cytosol	TAS		10747907
GO:0005856	cytoskeleton	IEA		-
GO:0005875	microtubule associated complex	TAS		10747907
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	IDA		8522593
GO:0005886	plasma membrane	ISS		-
GO:0045298	tubulin complex	IDA		8642405
GO:0045298	tubulin complex	ISS		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AATF	CHE-1 \| CHE1 \| DED	apoptosis antagonizing transcription factor	-	HPRD,BioGRID	14697667
APOE	AD2 \| LPG \| MGC1571 \| apoprotein	apolipoprotein E	Reconstituted Complex	BioGRID	8620924
APOE	AD2 \| LPG \| MGC1571 \| apoprotein	apolipoprotein E	-	HPRD	7566652 \|9147408
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	-	HPRD,BioGRID	2123288
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	11826099
GSK3B	-	glycogen synthase kinase 3 beta	GSK3beta phosphorylates Ftau.This interaction was modelled on a demonstrated interaction between rabbit GSK3beta and human Ftau.	BIND	14636947
MARK4	FLJ90097 \| KIAA1860 \| MARKL1 \| Nbla00650	MAP/microtubule affinity-regulating kinase 4	-	HPRD,BioGRID	14594945
OGT	FLJ23071 \| HRNT1 \| MGC22921 \| O-GLCNAC	O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)	-	HPRD,BioGRID	8910513 \|12911634
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	-	HPRD,BioGRID	10391244
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	-	HPRD,BioGRID	9689133
S100B	NEF \| S100 \| S100beta	S100 calcium binding protein B	-	HPRD	11264299
S100B	NEF \| S100 \| S100beta	S100 calcium binding protein B	-	HPRD,BioGRID	2833519
SNCA	MGC110988 \| NACP \| PARK1 \| PARK4 \| PD1	synuclein, alpha (non A4 component of amyloid precursor)	-	HPRD,BioGRID	10464279
SPTB	HSpTB1	spectrin, beta, erythrocytic	-	HPRD,BioGRID	6743699
STXBP1	EIEE4 \| MUNC18-1 \| UNC18 \| hUNC18 \| rbSec1	syntaxin binding protein 1	-	HPRD,BioGRID	12963086
TUBB2A	TUBB \| TUBB2 \| dJ40E16.7	tubulin, beta 2A	-	HPRD	9922135
USP9Y	AZF \| AZF1 \| AZFA \| DFFRY \| FLJ33043 \| SP3	ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)	-	HPRD,BioGRID	1723470
YWHAA	-	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide	Affinity Capture-Western	BioGRID	12176984
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	-	HPRD,BioGRID	10840038
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	Tau interacts with 14-3-3-zeta.	BIND	12176984
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	-	HPRD,BioGRID	10840038

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
BIOCARTA BIOPEPTIDES PATHWAY	45	35	All SZGR 2.0 genes in this pathway
BIOCARTA P35ALZHEIMERS PATHWAY	11	9	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID P38 GAMMA DELTA PATHWAY	11	9	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS	40	26	All SZGR 2.0 genes in this pathway
REACTOME CASPASE MEDIATED CLEAVAGE OF CYTOSKELETAL PROTEINS	13	11	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC EXECUTION PHASE	54	37	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN	244	147	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP	184	125	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP	119	66	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
TERAMOTO OPN TARGETS CLUSTER 8	8	7	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 UP	36	22	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL UP	37	28	All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION	88	68	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS DN	31	23	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP	95	64	All SZGR 2.0 genes in this pathway
MCDOWELL ACUTE LUNG INJURY DN	48	33	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3	97	72	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
LEE METASTASIS AND ALTERNATIVE SPLICING DN	45	31	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MASSARWEH RESPONSE TO ESTRADIOL	61	47	All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION DN	60	38	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN	58	39	All SZGR 2.0 genes in this pathway
HUANG DASATINIB RESISTANCE DN	69	44	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE UP	36	24	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN	134	83	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
FARDIN HYPOXIA 11	32	29	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION DN	12	10	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	4068	4074	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-214	2039	2045	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-219	3175	3181	m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-27	4065	4071	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	4065	4071	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-34/449	1187	1193	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MAPT