SZGR2

Summary ?

GeneID	4359
Symbol	MPZ
Synonyms	CHM\|CMT1\|CMT1B\|CMT2I\|CMT2J\|CMT4E\|CMTDI3\|CMTDID\|DSS\|HMSNIB\|MPP\|P0
Description	myelin protein zero
Reference	MIM:159440\|HGNC:HGNC:7225\|Ensembl:ENSG00000158887\|HPRD:01159\|Vega:OTTHUMG00000034341
Gene type	protein-coding
Map location	1q23.3
Fetal beta	-0.321

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0005198	structural molecule activity	NAS		7693129
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008366	axon ensheathment	NAS	neuron, axon (GO term level: 12)	-
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	7693129
GO:0007638	mechanosensory behavior	IEA		-
GO:0045217	cell-cell junction maintenance	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0016020	membrane	IEA		-
GO:0005886	plasma membrane	NAS		7693130
GO:0005887	integral to plasma membrane	TAS		7506095

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL ADHESION MOLECULES CAMS	134	93	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN	196	131	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK DN	79	54	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS DN	108	84	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	321	327	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-149	790	796	m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-203.1	1130	1136	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-223	1126	1132	1A	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-485-5p	141	148	1A,m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MPZ