|
|
| GeneID |
4552
|
| Symbol |
MTRR
|
| Synonyms |
MGC129643|MSR
|
| Description |
5-methyltetrahydrofolate-homocysteine methyltransferase reductase |
| See related |
HGNC:7473|MIM:602568|Ensembl:ENSG00000124275|HPRD:03979| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
5p15.3-p15.2 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia] | Click to show detail |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005506 | iron ion binding | IEA | | - |
| GO:0016740 | transferase activity | IEA | | - |
| GO:0008168 | methyltransferase activity | IEA | | - |
| GO:0010181 | FMN binding | IEA | | - |
| GO:0010181 | FMN binding | TAS | | 9501215 |
| GO:0009055 | electron carrier activity | IEA | | - |
| GO:0016491 | oxidoreductase activity | IEA | | - |
| GO:0030586 | [methionine synthase] reductase activity | TAS | | 9501215 |
| GO:0050660 | FAD binding | TAS | | 9501215 |
| GO:0050661 | NADP binding | TAS | | 9501215 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0009086 | methionine biosynthetic process | IEA | | - |
| GO:0008652 | amino acid biosynthetic process | IEA | | - |
| GO:0055114 | oxidation reduction | TAS | | 9501215 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005829 | cytosol | TAS | | 9501215 |
| GO:0005737 | cytoplasm | IEA | | - |
| GO:0005739 | mitochondrion | IEA | | - |
| |
|
|
|
| miR-361 | 538 | 545 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|