Gene Page: ROR2

Summary
GeneID  4920
Symbol  ROR2
Synonyms  BDB|BDB1|MGC163394|NTRKR2
Description  receptor tyrosine kinase-like orphan receptor 2
See related  HGNC:10257|MIM:602337|Ensembl:ENSG00000169071|HPRD:03822|
Locus tag  RP11-8I8.2
Gene type  protein-coding
Map location  9q22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004714transmembrane receptor protein tyrosine kinase activityTASneurite (GO term level: 8)1334494 
GO:0000166nucleotide bindingIEA-
GO:0004872receptor activityIEA-
GO:0005524ATP bindingIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0007165signal transductionTAS1334494 
GO:0007275multicellular organismal developmentTAS1334494 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS1334494 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1-HPRD,BioGRID12754255 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
PID_WNT_NONCANONICAL_PATHWAY 3226All SZGR genes in this pathway
PID_WNT_SIGNALING_PATHWAY 2823All SZGR genes in this pathway
DELYS_THYROID_CANCER_DN 232154All SZGR genes in this pathway
GAUSSMANN_MLL_AF4_FUSION_TARGETS_G_UP 238135All SZGR genes in this pathway
KORKOLA_YOLK_SAC_TUMOR 6233All SZGR genes in this pathway
LI_WILMS_TUMOR_VS_FETAL_KIDNEY_2_UP 3024All SZGR genes in this pathway
LOPEZ_MBD_TARGETS 957597All SZGR genes in this pathway
LI_WILMS_TUMOR_VS_FETAL_KIDNEY_1_DN 163115All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_16HR_DN 8662All SZGR genes in this pathway
WESTON_VEGFA_TARGETS_6HR 5938All SZGR genes in this pathway
KAAB_HEART_ATRIUM_VS_VENTRICLE_UP 249170All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_20HR_DN 10170All SZGR genes in this pathway
WESTON_VEGFA_TARGETS 10871All SZGR genes in this pathway
KRASNOSELSKAYA_ILF3_TARGETS_DN 4638All SZGR genes in this pathway
SANSOM_APC_TARGETS 212121All SZGR genes in this pathway
SANSOM_APC_MYC_TARGETS 217138All SZGR genes in this pathway
SANSOM_APC_TARGETS_REQUIRE_MYC 210123All SZGR genes in this pathway
SANSOM_WNT_PATHWAY_REQUIRE_MYC 5843All SZGR genes in this pathway
GRADE_COLON_CANCER_UP 871505All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
ROME_INSULIN_TARGETS_IN_MUSCLE_DN 204114All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME2 491319All SZGR genes in this pathway
NAKAYAMA_SOFT_TISSUE_TUMORS_PCA2_UP 8750All SZGR genes in this pathway
KIM_ALL_DISORDERS_CALB1_CORR_DN 3720All SZGR genes in this pathway
FEVR_CTNNB1_TARGETS_DN 553343All SZGR genes in this pathway
DURAND_STROMA_S_UP 297194All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506609615m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.