Gene Page: ROR2
Summary ?
| GeneID | 4920 |
| Symbol | ROR2 |
| Synonyms | BDB|BDB1|NTRKR2 |
| Description | receptor tyrosine kinase-like orphan receptor 2 |
| Reference | MIM:602337|HGNC:HGNC:10257|Ensembl:ENSG00000169071|HPRD:03822|Vega:OTTHUMG00000020211 |
| Gene type | protein-coding |
| Map location | 9q22 |
| Pascal p-value | 0.004 |
| Fetal beta | -0.084 |
| DMG | 1 (# studies) |
| eGene | Cortex |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg13966448 | 9 | 94659196 | ROR2 | 4.708E-4 | -0.582 | 0.046 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004714 | transmembrane receptor protein tyrosine kinase activity | TAS | neurite (GO term level: 8) | 1334494 |
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0007165 | signal transduction | TAS | 1334494 | |
| GO:0007275 | multicellular organismal development | TAS | 1334494 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 1334494 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID WNT NONCANONICAL PATHWAY | 32 | 26 | All SZGR 2.0 genes in this pathway |
| PID WNT SIGNALING PATHWAY | 28 | 23 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| KORKOLA YOLK SAC TUMOR | 62 | 33 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 2 UP | 30 | 24 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
| WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
| WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
| KRASNOSELSKAYA ILF3 TARGETS DN | 46 | 38 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
| SANSOM APC MYC TARGETS | 217 | 138 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS REQUIRE MYC | 210 | 123 | All SZGR 2.0 genes in this pathway |
| SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR DN | 37 | 20 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 609 | 615 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.