Gene Page: DDR2
Summary ?
| GeneID | 4921 |
| Symbol | DDR2 |
| Synonyms | MIG20a|NTRKR3|TKT|TYRO10 |
| Description | discoidin domain receptor tyrosine kinase 2 |
| Reference | MIM:191311|HGNC:HGNC:2731|Ensembl:ENSG00000162733|HPRD:01868|Vega:OTTHUMG00000034423 |
| Gene type | protein-coding |
| Map location | 1q23.3 |
| Sherlock p-value | 1.748E-4 |
| Fetal beta | -0.45 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs878715 | chr7 | 156383236 | DDR2 | 4921 | 0.14 | trans | ||
| rs878716 | chr7 | 156383347 | DDR2 | 4921 | 0.08 | trans | ||
| rs7039404 | chr9 | 90934986 | DDR2 | 4921 | 0.03 | trans | ||
| rs5915856 | chrX | 4792060 | DDR2 | 4921 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ATAD1 | 0.93 | 0.93 |
| AVL9 | 0.92 | 0.94 |
| LRPPRC | 0.92 | 0.94 |
| SCAMP1 | 0.92 | 0.94 |
| ARCN1 | 0.92 | 0.94 |
| ATF2 | 0.92 | 0.93 |
| USP33 | 0.91 | 0.93 |
| MBTPS2 | 0.91 | 0.93 |
| ELAVL2 | 0.91 | 0.92 |
| SPIN1 | 0.91 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.73 | -0.76 |
| MT-CO2 | -0.73 | -0.77 |
| AF347015.31 | -0.72 | -0.76 |
| HIGD1B | -0.71 | -0.76 |
| AF347015.8 | -0.70 | -0.76 |
| AF347015.33 | -0.70 | -0.74 |
| AF347015.2 | -0.70 | -0.74 |
| MT-CYB | -0.69 | -0.73 |
| AF347015.21 | -0.69 | -0.74 |
| IFI27 | -0.68 | -0.73 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004714 | transmembrane receptor protein tyrosine kinase activity | IEA | neurite (GO term level: 8) | - |
| GO:0004714 | transmembrane receptor protein tyrosine kinase activity | TAS | neurite (GO term level: 8) | 9659899 |
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004713 | protein tyrosine kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0016301 | kinase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
| GO:0007155 | cell adhesion | IEA | - | |
| GO:0007155 | cell adhesion | TAS | 9659899 | |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0007165 | signal transduction | TAS | 9659899 | |
| GO:0008284 | positive regulation of cell proliferation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 9659899 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
| LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
| LA MEN1 TARGETS | 24 | 15 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
| GROSS HIF1A TARGETS UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
| LIU LIVER CANCER | 38 | 18 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| LEE TARGETS OF PTCH1 AND SUFU UP | 53 | 37 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
| JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION UP | 71 | 51 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
| WEIGEL OXIDATIVE STRESS BY HNE AND H2O2 | 39 | 29 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| GAJATE RESPONSE TO TRABECTEDIN UP | 67 | 45 | All SZGR 2.0 genes in this pathway |
| ZHU CMV 24 HR DN | 91 | 64 | All SZGR 2.0 genes in this pathway |
| ZHU CMV ALL DN | 128 | 93 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
| ABE INNER EAR | 48 | 26 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
| MATZUK CENTRAL FOR FEMALE FERTILITY | 29 | 25 | All SZGR 2.0 genes in this pathway |
| MATZUK EARLY ANTRAL FOLLICLE | 13 | 11 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| SHAFFER IRF4 MULTIPLE MYELOMA PROGRAM | 36 | 25 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA | 43 | 27 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| CHEN LIVER METABOLISM QTL CIS | 93 | 40 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-122 | 75 | 81 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.