SZGR2

Summary ?

GeneID	493
Symbol	ATP2B4
Synonyms	ATP2B2\|MXRA1\|PMCA4\|PMCA4b\|PMCA4x
Description	ATPase plasma membrane Ca2+ transporting 4
Reference	MIM:108732\|HGNC:HGNC:817\|Ensembl:ENSG00000058668\|HPRD:00159\|Vega:OTTHUMG00000035906
Gene type	protein-coding
Map location	1q32.1
Fetal beta	-1.682
DMG	2 (# studies)
Support	ION BALANCE G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_PocklingtonH1 G2Cdb.human_Synaptosome G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
DNM:Awadalla_2010	Whole Exome Sequencing analysis	A survey of ~430 Mb of DNA from 401 synapse-expressed genes across all cases and 25 Mb of DNA in controls found 28 candidate DNMs.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1631

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ATP2B4	chr1	203668781	C	T	ATP2B4:NM_001001396:exon4:c.C585T:p.N195N ATP2B4:NM_001684:exon4:c.C585T:p.N195N	N195N	synonymous SNV			Disorganized Schizophrenia	DNM:Awadalla_2010

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg19087104	1	203643746	ATP2B4	1.93E-5	0.28	0.016	DMG:Wockner_2014
cg19791253	1	203595809	ATP2B4		-0.023	0.26	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005516	calmodulin binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0005388	calcium-transporting ATPase activity	TAS		2137451
GO:0016787	hydrolase activity	IEA		-
GO:0016820	hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008152	metabolic process	IEA		-
GO:0006816	calcium ion transport	IEA		-
GO:0006812	cation transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	TAS		2137451 \|10748016
GO:0005887	integral to plasma membrane	TAS		2137451

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP	137	94	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN	68	49	All SZGR 2.0 genes in this pathway
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION DN	15	11	All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE DN	66	44	All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES UP	82	51	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP	177	110	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP	119	66	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN	67	43	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
DUNNE TARGETS OF AML1 MTG8 FUSION UP	52	32	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN	97	51	All SZGR 2.0 genes in this pathway
TOMLINS PROSTATE CANCER DN	40	33	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN	31	23	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
BALDWIN PRKCI TARGETS UP	35	26	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP	283	177	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
ROSS ACUTE MYELOID LEUKEMIA CBF	82	57	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
SWEET KRAS TARGETS UP	84	51	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN	86	62	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR DN	148	102	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
KUNINGER IGF1 VS PDGFB TARGETS UP	82	51	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE E2	28	21	All SZGR 2.0 genes in this pathway
HUANG FOXA2 TARGETS DN	36	21	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOZOA	114	77	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS UP	153	107	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP	61	44	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP	221	120	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	3308	3314	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
				hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124/506	1458	1464	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1458	1464	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-129-5p	2241	2247	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	2241	2247	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-135	3524	3530	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
				hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-142-5p	2447	2453	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-148/152	4195	4202	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	2238	2244	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-183	3714	3720	1A	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-186	2256	2262	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-214	3615	3621	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-29	2635	2641	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-324-3p	2589	2595	m8	hsa-miR-324-3p	CCACUGCCCCAGGUGCUGCUGG
miR-448	2237	2244	1A,m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	2241	2247	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ATP2B4