Gene Page: APH1A
Summary ?
GeneID | 51107 |
Symbol | APH1A |
Synonyms | 6530402N02Rik|APH-1|APH-1A|CGI-78 |
Description | aph-1 homolog A, gamma secretase subunit |
Reference | MIM:607629|HGNC:HGNC:29509|Ensembl:ENSG00000117362|Vega:OTTHUMG00000012545 |
Gene type | protein-coding |
Map location | 1p36.13-q31.3 |
Sherlock p-value | 5.287E-4 |
Fetal beta | 0.972 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia |
Support | NEUROTROPHIN SIGNALING |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06766579 | 1 | 150242418 | APH1A | 5.289E-4 | 0.273 | 0.048 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 12297508 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042987 | amyloid precursor protein catabolic process | IMP | 12297508 | |
GO:0006509 | membrane protein ectodomain proteolysis | IDA | 15274632 | |
GO:0007220 | Notch receptor processing | IMP | 12297508 | |
GO:0016485 | protein processing | IDA | 15274632 | |
GO:0016485 | protein processing | IEA | - | |
GO:0031293 | membrane protein intracellular domain proteolysis | IMP | 12297508 | |
GO:0043085 | positive regulation of catalytic activity | IDA | 15274632 | |
GO:0043085 | positive regulation of catalytic activity | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | IDA | 15274632 | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005783 | endoplasmic reticulum | IDA | 15274632 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | IDA | 15274632 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
PID PS1 PATHWAY | 46 | 39 | All SZGR 2.0 genes in this pathway |
PID P75 NTR PATHWAY | 69 | 51 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 3 PATHWAY | 17 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR SIGNALING BY ERBB4 | 38 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH4 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH2 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH3 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATED PROTEOLYSIS OF P75NTR | 10 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME NRIF SIGNALS CELL DEATH FROM THE NUCLEUS | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP | 175 | 108 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS DN | 12 | 9 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
CHANGOLKAR H2AFY TARGETS UP | 48 | 28 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-122 | 522 | 528 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
miR-204/211 | 98 | 104 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-539 | 206 | 212 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.