SZGR2

Summary ?

GeneID	51523
Symbol	CXXC5
Synonyms	CF5\|HSPC195\|RINF\|WID
Description	CXXC finger protein 5
Reference	MIM:612752\|HGNC:HGNC:26943\|Ensembl:ENSG00000171604\|HPRD:13105\|Vega:OTTHUMG00000163331
Gene type	protein-coding
Map location	5q31.2
Pascal p-value	4.515E-5
Sherlock p-value	0.705

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.0032

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	PubMed ID
GO:0003677	DNA binding	IEA	-
GO:0008270	zinc ion binding	IEA	-
GO:0046872	metal ion binding	IEA	-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA DN	349	157	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
SAMOLS TARGETS OF KHSV MIRNAS DN	62	35	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP	265	158	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
CASTELLANO HRAS AND NRAS TARGETS DN	8	6	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN	24	15	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER HEREDITARY VS SPORADIC	50	32	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN	540	340	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE UP	107	59	All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN	138	99	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 DN	45	30	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN	214	124	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	408	414	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	408	414	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-181	360	366	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-186	457	463	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-188	61	67	m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-214	893	900	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-219	293	300	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-25/32/92/363/367	30	36	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-324-5p	84	90	1A	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU
miR-363	29	35	m8	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-410	139	145	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-496	362	368	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CXXC5