Gene Page: ATP5G2
Summary ?
| GeneID | 517 |
| Symbol | ATP5G2 |
| Synonyms | ATP5A |
| Description | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C2 (subunit 9) |
| Reference | MIM:603193|HGNC:HGNC:842|Ensembl:ENSG00000135390|HPRD:04429|Vega:OTTHUMG00000133442 |
| Gene type | protein-coding |
| Map location | 12q13.13 |
| Pascal p-value | 0.06 |
| Fetal beta | 0.166 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| Expression | Meta-analysis of gene expression | P value: 2.556 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg02056144 | 12 | 54070517 | ATP5G2 | 3.51E-5 | 0.649 | 0.02 | DMG:Wockner_2014 |
| cg22997177 | 12 | 54070527 | ATP5G2 | 5.968E-4 | 0.746 | 0.05 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs59921666 | 12 | 53688489 | ATP5G2 | ENSG00000135390.13 | 4.107E-6 | 0 | 382703 | gtex_brain_putamen_basal |
| rs11170594 | 12 | 53944119 | ATP5G2 | ENSG00000135390.13 | 1.942E-8 | 0 | 127073 | gtex_brain_putamen_basal |
| rs7970047 | 12 | 53971255 | ATP5G2 | ENSG00000135390.13 | 3.812E-6 | 0 | 99937 | gtex_brain_putamen_basal |
| rs4019971 | 12 | 53978715 | ATP5G2 | ENSG00000135390.13 | 6.165E-7 | 0 | 92477 | gtex_brain_putamen_basal |
| rs3852551 | 12 | 53979505 | ATP5G2 | ENSG00000135390.13 | 6.059E-7 | 0 | 91687 | gtex_brain_putamen_basal |
| rs10783586 | 12 | 53980821 | ATP5G2 | ENSG00000135390.13 | 4.354E-6 | 0 | 90371 | gtex_brain_putamen_basal |
| rs10876466 | 12 | 53981426 | ATP5G2 | ENSG00000135390.13 | 6.059E-7 | 0 | 89766 | gtex_brain_putamen_basal |
| rs7312372 | 12 | 53999121 | ATP5G2 | ENSG00000135390.13 | 7.667E-7 | 0 | 72071 | gtex_brain_putamen_basal |
| rs10747675 | 12 | 54000031 | ATP5G2 | ENSG00000135390.13 | 4.354E-6 | 0 | 71161 | gtex_brain_putamen_basal |
| rs7311902 | 12 | 54015236 | ATP5G2 | ENSG00000135390.13 | 2.652E-6 | 0 | 55956 | gtex_brain_putamen_basal |
| rs7970462 | 12 | 54022602 | ATP5G2 | ENSG00000135390.13 | 2.082E-8 | 0 | 48590 | gtex_brain_putamen_basal |
| rs11170631 | 12 | 54041192 | ATP5G2 | ENSG00000135390.13 | 2.866E-9 | 0 | 30000 | gtex_brain_putamen_basal |
| rs4759278 | 12 | 54055801 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 15391 | gtex_brain_putamen_basal |
| rs112183557 | 12 | 54056555 | ATP5G2 | ENSG00000135390.13 | 1.722E-11 | 0 | 14637 | gtex_brain_putamen_basal |
| rs79942047 | 12 | 54056747 | ATP5G2 | ENSG00000135390.13 | 5.76E-12 | 0 | 14445 | gtex_brain_putamen_basal |
| rs61141630 | 12 | 54057067 | ATP5G2 | ENSG00000135390.13 | 2.392E-12 | 0 | 14125 | gtex_brain_putamen_basal |
| rs56963435 | 12 | 54057912 | ATP5G2 | ENSG00000135390.13 | 3.782E-12 | 0 | 13280 | gtex_brain_putamen_basal |
| rs1971762 | 12 | 54058238 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 12954 | gtex_brain_putamen_basal |
| rs11170639 | 12 | 54060451 | ATP5G2 | ENSG00000135390.13 | 1.482E-11 | 0 | 10741 | gtex_brain_putamen_basal |
| rs7965111 | 12 | 54061357 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 9835 | gtex_brain_putamen_basal |
| rs1800633 | 12 | 54063501 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 7691 | gtex_brain_putamen_basal |
| rs4759279 | 12 | 54064888 | ATP5G2 | ENSG00000135390.13 | 2.54E-6 | 0 | 6304 | gtex_brain_putamen_basal |
| rs10876480 | 12 | 54066271 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 4921 | gtex_brain_putamen_basal |
| rs10876481 | 12 | 54066743 | ATP5G2 | ENSG00000135390.13 | 3.779E-12 | 0 | 4449 | gtex_brain_putamen_basal |
| rs916134 | 12 | 54069803 | ATP5G2 | ENSG00000135390.13 | 3.055E-13 | 0 | 1389 | gtex_brain_putamen_basal |
| rs3892761 | 12 | 54070445 | ATP5G2 | ENSG00000135390.13 | 2.28E-12 | 0 | 747 | gtex_brain_putamen_basal |
| rs12818213 | 12 | 54072007 | ATP5G2 | ENSG00000135390.13 | 4.421E-13 | 0 | -815 | gtex_brain_putamen_basal |
| rs4759282 | 12 | 54072435 | ATP5G2 | ENSG00000135390.13 | 1.924E-10 | 0 | -1243 | gtex_brain_putamen_basal |
| rs7963016 | 12 | 54072819 | ATP5G2 | ENSG00000135390.13 | 1.985E-10 | 0 | -1627 | gtex_brain_putamen_basal |
| rs7976793 | 12 | 54073069 | ATP5G2 | ENSG00000135390.13 | 3.629E-10 | 0 | -1877 | gtex_brain_putamen_basal |
| rs7312853 | 12 | 54073597 | ATP5G2 | ENSG00000135390.13 | 1.912E-10 | 0 | -2405 | gtex_brain_putamen_basal |
| rs12424729 | 12 | 54073928 | ATP5G2 | ENSG00000135390.13 | 1.881E-10 | 0 | -2736 | gtex_brain_putamen_basal |
| rs11170643 | 12 | 54074777 | ATP5G2 | ENSG00000135390.13 | 3.939E-9 | 0 | -3585 | gtex_brain_putamen_basal |
| rs11170646 | 12 | 54087253 | ATP5G2 | ENSG00000135390.13 | 2.568E-10 | 0 | -16061 | gtex_brain_putamen_basal |
| rs12830769 | 12 | 54087705 | ATP5G2 | ENSG00000135390.13 | 1.921E-10 | 0 | -16513 | gtex_brain_putamen_basal |
| rs111714152 | 12 | 54092021 | ATP5G2 | ENSG00000135390.13 | 8.45E-7 | 0 | -20829 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005215 | transporter activity | NAS | 8328972 | |
| GO:0008289 | lipid binding | IEA | - | |
| GO:0046933 | hydrogen ion transporting ATP synthase activity, rotational mechanism | IEA | - | |
| GO:0046961 | hydrogen ion transporting ATPase activity, rotational mechanism | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006811 | ion transport | IEA | - | |
| GO:0015992 | proton transport | IEA | - | |
| GO:0015986 | ATP synthesis coupled proton transport | IEA | - | |
| GO:0046034 | ATP metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005753 | mitochondrial proton-transporting ATP synthase complex | TAS | 8328972 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0016469 | proton-transporting two-sector ATPase complex | IEA | - | |
| GO:0031966 | mitochondrial membrane | IEA | - | |
| GO:0045263 | proton-transporting ATP synthase complex, coupling factor F(o) | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG OXIDATIVE PHOSPHORYLATION | 135 | 73 | All SZGR 2.0 genes in this pathway |
| KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
| KEGG PARKINSONS DISEASE | 133 | 78 | All SZGR 2.0 genes in this pathway |
| KEGG HUNTINGTONS DISEASE | 185 | 109 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
| MOOTHA VOXPHOS | 87 | 51 | All SZGR 2.0 genes in this pathway |
| POMEROY MEDULLOBLASTOMA PROGNOSIS DN | 43 | 28 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO CANTHARIDIN DN | 69 | 46 | All SZGR 2.0 genes in this pathway |
| ZHOU TNF SIGNALING 30MIN | 54 | 36 | All SZGR 2.0 genes in this pathway |
| HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
| WONG MITOCHONDRIA GENE MODULE | 217 | 122 | All SZGR 2.0 genes in this pathway |
| MALONEY RESPONSE TO 17AAG UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS LOW SERUM | 100 | 51 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 129 | 135 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-125/351 | 98 | 104 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-144 | 128 | 135 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.