Gene Page: PHKG2
Summary ?
GeneID | 5261 |
Symbol | PHKG2 |
Synonyms | GSD9C |
Description | phosphorylase kinase, gamma 2 (testis) |
Reference | MIM:172471|HGNC:HGNC:8931|Ensembl:ENSG00000156873|HPRD:01405|Vega:OTTHUMG00000132400 |
Gene type | protein-coding |
Map location | 16p11.2 |
Pascal p-value | 0.034 |
Sherlock p-value | 0.008 |
Fetal beta | -0.633 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02091607 | 16 | 30760815 | PHKG2 | 5.49E-4 | 0.282 | 0.049 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CABLES2 | 0.91 | 0.94 |
PTPRS | 0.90 | 0.93 |
USP22 | 0.90 | 0.93 |
C17orf63 | 0.89 | 0.91 |
ARID1B | 0.89 | 0.91 |
PHF12 | 0.89 | 0.90 |
FOXK2 | 0.89 | 0.92 |
ZNF142 | 0.89 | 0.91 |
YTHDF1 | 0.89 | 0.92 |
TGFBRAP1 | 0.88 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.71 | -0.82 |
MT-CO2 | -0.69 | -0.83 |
AF347015.27 | -0.68 | -0.80 |
C5orf53 | -0.66 | -0.71 |
MT-CYB | -0.66 | -0.78 |
FXYD1 | -0.66 | -0.77 |
AF347015.33 | -0.66 | -0.75 |
IFI27 | -0.66 | -0.77 |
AF347015.8 | -0.66 | -0.80 |
HIGD1B | -0.66 | -0.80 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0005524 | ATP binding | NAS | - | |
GO:0004672 | protein kinase activity | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | NAS | - | |
GO:0004689 | phosphorylase kinase activity | NAS | 8020963 | |
GO:0004689 | phosphorylase kinase activity | TAS | 2948189 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | NAS | - | |
GO:0006091 | generation of precursor metabolites and energy | TAS | 8896567 | |
GO:0005978 | glycogen biosynthetic process | IEA | - | |
GO:0005975 | carbohydrate metabolic process | IEA | - | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005964 | phosphorylase kinase complex | IEA | - | |
GO:0005964 | phosphorylase kinase complex | NAS | 8020963 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
REACTOME GLYCOGEN BREAKDOWN GLYCOGENOLYSIS | 18 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
REACTOME GLUCOSE METABOLISM | 69 | 42 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SU TESTIS | 76 | 53 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS DN | 141 | 92 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 57 | 63 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.