Gene Page: PLXNA2
Summary ?
| GeneID | 5362 |
| Symbol | PLXNA2 |
| Synonyms | OCT|PLXN2 |
| Description | plexin A2 |
| Reference | MIM:601054|HGNC:HGNC:9100|Ensembl:ENSG00000076356|HPRD:03033|Vega:OTTHUMG00000036564 |
| Gene type | protein-coding |
| Map location | 1q32.2 |
| Sherlock p-value | 0.275 |
| Fetal beta | 1.239 |
| eGene | Anterior cingulate cortex BA24 Meta |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs865199 | 1 | 208028592 | PLXNA2 | ENSG00000076356.6 | 4.2908E-7 | 0.01 | 389073 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RBM5 | 0.94 | 0.94 |
| PRPF3 | 0.93 | 0.93 |
| METTL3 | 0.93 | 0.92 |
| RBM6 | 0.92 | 0.93 |
| ZNF509 | 0.92 | 0.93 |
| HARS2 | 0.92 | 0.91 |
| ZCCHC8 | 0.91 | 0.92 |
| ZNF7 | 0.91 | 0.92 |
| CCNL1 | 0.91 | 0.92 |
| ZNF211 | 0.91 | 0.90 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.76 | -0.87 |
| AF347015.27 | -0.74 | -0.85 |
| MT-CO2 | -0.74 | -0.85 |
| MT-CYB | -0.71 | -0.82 |
| IFI27 | -0.71 | -0.82 |
| AF347015.33 | -0.71 | -0.80 |
| AIFM3 | -0.70 | -0.73 |
| AF347015.8 | -0.70 | -0.83 |
| HLA-F | -0.70 | -0.71 |
| HIGD1B | -0.68 | -0.81 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME CRMPS IN SEMA3A SIGNALING | 14 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME OTHER SEMAPHORIN INTERACTIONS | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PAK DEPENDENT AXON REPULSION | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PLEXIN REPULSION SIGNALING BY INHIBITING INTEGRIN ADHESION | 13 | 9 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
| HU ANGIOGENESIS DN | 37 | 25 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 1 | 45 | 27 | All SZGR 2.0 genes in this pathway |
| KORKOLA YOLK SAC TUMOR | 62 | 33 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
| JAZAERI BREAST CANCER BRCA1 VS BRCA2 DN | 43 | 31 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
| LEE METASTASIS AND ALTERNATIVE SPLICING UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| CHEN LIVER METABOLISM QTL CIS | 93 | 40 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 4940 | 4946 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-137 | 1174 | 1181 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-142-5p | 352 | 358 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-145 | 4730 | 4736 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-15/16/195/424/497 | 302 | 308 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-199 | 4728 | 4735 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-214 | 3780 | 3787 | 1A,m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-26 | 1180 | 1187 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-30-5p | 1164 | 1171 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-31 | 2052 | 2058 | m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-326 | 92 | 98 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
| miR-330 | 305 | 311 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-369-3p | 4740 | 4747 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 4741 | 4747 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-378 | 2105 | 2111 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-410 | 4948 | 4955 | 1A,m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.