Gene Page: PGPEP1
Summary ?
| GeneID | 54858 |
| Symbol | PGPEP1 |
| Synonyms | PAP-I|PGP|PGP-I|PGPI|Pcp |
| Description | pyroglutamyl-peptidase I |
| Reference | MIM:610694|HGNC:HGNC:13568|Ensembl:ENSG00000130517|HPRD:07141|Vega:OTTHUMG00000183358 |
| Gene type | protein-coding |
| Map location | 19p13.11 |
| Pascal p-value | 0.186 |
| Fetal beta | 0.573 |
| eGene | Caudate basal ganglia Cortex Nucleus accumbens basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Expression | Meta-analysis of gene expression | P value: 1.664 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17714461 | chr19 | 51425105 | PGPEP1 | 54858 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FBXO28 | 0.85 | 0.86 |
| HINT3 | 0.84 | 0.84 |
| DDHD1 | 0.84 | 0.83 |
| BTRC | 0.83 | 0.84 |
| APPL1 | 0.83 | 0.85 |
| HIF1AN | 0.83 | 0.82 |
| ARCN1 | 0.82 | 0.81 |
| AKAP10 | 0.82 | 0.83 |
| PAFAH1B1 | 0.82 | 0.83 |
| NAT13 | 0.82 | 0.83 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.67 | -0.60 |
| MT-CO2 | -0.66 | -0.62 |
| FXYD1 | -0.66 | -0.62 |
| AF347015.31 | -0.64 | -0.61 |
| HIGD1B | -0.63 | -0.61 |
| AF347015.8 | -0.63 | -0.60 |
| MT-CYB | -0.62 | -0.58 |
| AF347015.33 | -0.62 | -0.57 |
| AC098691.2 | -0.61 | -0.58 |
| IFI27 | -0.60 | -0.58 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008234 | cysteine-type peptidase activity | IEA | - | |
| GO:0008233 | peptidase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN | 98 | 59 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS UP | 108 | 78 | All SZGR 2.0 genes in this pathway |
| ZEMBUTSU SENSITIVITY TO CISPLATIN | 20 | 14 | All SZGR 2.0 genes in this pathway |
| ZEMBUTSU SENSITIVITY TO VINCRISTINE | 19 | 10 | All SZGR 2.0 genes in this pathway |
| NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
| DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR TARGETS UP | 48 | 33 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-151 | 5127 | 5133 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.