Gene Page: RCBTB1
Summary ?
GeneID | 55213 |
Symbol | RCBTB1 |
Synonyms | CLLD7|CLLL7|GLP |
Description | RCC1 and BTB domain containing protein 1 |
Reference | MIM:607867|HGNC:HGNC:18243|Ensembl:ENSG00000136144|HPRD:09713|Vega:OTTHUMG00000016915 |
Gene type | protein-coding |
Map location | 13q14 |
Pascal p-value | 0.017 |
DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=1.10:CC_BA10_disease_P=0.0455:HBB_BA9_fold_change=1.15:HBB_BA9_disease_P=0.0301 |
Fetal beta | -0.186 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellar Hemisphere Cortex Frontal Cortex BA9 Nucleus accumbens basal ganglia Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg00852613 | 13 | 50159829 | RCBTB1 | 2.21E-6 | -0.39 | 0.008 | DMG:Wockner_2014 |
cg17487741 | 13 | 50107026 | RCBTB1 | 3.353E-4 | -0.35 | 0.041 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
GO:0016568 | chromatin modification | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IDA | 11256614 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED DN | 86 | 47 | All SZGR 2.0 genes in this pathway |
HUMMEL BURKITTS LYMPHOMA UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
TCGA GLIOBLASTOMA COPY NUMBER DN | 31 | 21 | All SZGR 2.0 genes in this pathway |
ROSS ACUTE MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH AML1 ETO FUSION | 76 | 55 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
CHUANG OXIDATIVE STRESS RESPONSE UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
SAFFORD T LYMPHOCYTE ANERGY | 87 | 54 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER DN | 41 | 34 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-145 | 2086 | 2092 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-218 | 1753 | 1760 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-26 | 1729 | 1736 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.